Basic Information

Type: gene

Biological Identity

Species

malus_domestica

Chromosome

Chr08

Orthogroup ID

OG0024402

Physical Location & Seq

Genomic Coordinates Forward (+)

8385071 .. 8387180

Gene Structure 2110 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

MD08G1099800.v1.1.491

Sequence Viewer

CDS Protein Promoter (2k)

Length: 186 bp

ATGTCTTCTTTGCCAGTGGTAGAGGTGGCAAGATATACCAAAGTTGTTACTTGCTTAGCATATGGCATTTCTGGAAATTATTTGATTTCTAGATTAGAAGATGGCGTGGTCCGACTTTGGGATGCTAGAACTCATAATATTCTTCGCGTGTTCAAACACACAAAAGGTTATCTCAATTCTATTTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000151 GO:0005575 GO:0005622 GO:0005623 GO:0008150 GO:0031461 GO:0032991 GO:0044424 GO:0044464 GO:0048509 GO:0048519 GO:0050789 GO:0050793 GO:0051093 GO:0065007 GO:0080008 GO:1902183 GO:1902184 GO:1902494 GO:1990234

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

WD40

Protein Analysis

62

Amino Acids

6.93

Weight (kDa)

9.65

Isoelectric Point (pI)

41.2

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
Beta-prop_WDR5	PF25175	9 - 53	1.1e-06	WDR5 beta-propeller domain

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0024402)

Species	Orthologous Gene IDs
malus_domestica	MD08G1098500.v1.1 MD08G1099800.v1.1
pyrus_communis	pycom08g08110

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccII	CGCG	1 cut(s)	147
AfiI	CCNNNNNNNGG	1 cut(s)	118
AgsI	TTSAA	1 cut(s)	154
AspS9I	GGNCC	1 cut(s)	109
AvaII	GGWCC	1 cut(s)	109
BccI	CCATC	1 cut(s)	95
BfaI	CTAG	2 cut(s)	90, 126
BlpI	GCTNAGC	1 cut(s)	55
Bme18I	GGWCC	1 cut(s)	109
BmgT120I	GGNCC	1 cut(s)	109
BmsI	GCATC	1 cut(s)	112
Bpu1102I	GCTNAGC	1 cut(s)	55
Bsc4I	CCNNNNNNNGG	1 cut(s)	118
Bse1I	ACTGG	1 cut(s)	14
BseGI	GGATG	1 cut(s)	127
BseLI	CCNNNNNNNGG	1 cut(s)	118
BseNI	ACTGG	1 cut(s)	14
Bsh1236I	CGCG	1 cut(s)	147
BslI	CCNNNNNNNGG	1 cut(s)	118
Bsp1720I	GCTNAGC	1 cut(s)	55
BspFNI	CGCG	1 cut(s)	147
BsrI	ACTGG	1 cut(s)	14
BstDEI	CTNAG	1 cut(s)	55
BstF5I	GGATG	1 cut(s)	127
BstFNI	CGCG	1 cut(s)	147
BstUI	CGCG	1 cut(s)	147
BtsCI	GGATG	1 cut(s)	127
BtsIMutI	CAGTG	1 cut(s)	21
Cfr13I	GGNCC	1 cut(s)	109
DdeI	CTNAG	1 cut(s)	55
Eco47I	GGWCC	1 cut(s)	109
FaiI	YATR	4 cut(s)	36, 61, 63, 135
FauNDI	CATATG	1 cut(s)	61
FokI	GGATG	1 cut(s)	134
FspBI	CTAG	2 cut(s)	90, 126
Hpy188I	TCNGA	1 cut(s)	113
Hpy188III	TCNNGA	2 cut(s)	72, 90
HpyF3I	CTNAG	1 cut(s)	55
LpnPI	CCDG	2 cut(s)	27, 57
LweI	GCATC	1 cut(s)	112
MaeI	CTAG	2 cut(s)	90, 126
MaeIII	GTNAC	1 cut(s)	46
MboII	GAAGA	2 cut(s)	110, 134
MluCI	AATT	2 cut(s)	76, 175
MmeI	TCCRAC	1 cut(s)	136
MnlI	CCTC	1 cut(s)	16
MvnI	CGCG	1 cut(s)	147
NdeI	CATATG	1 cut(s)	61
PspPI	GGNCC	1 cut(s)	109
Sau96I	GGNCC	1 cut(s)	109
SetI	ASST	2 cut(s)	27, 169
SfaNI	GCATC	1 cut(s)	112
SgeI	CNNG	9 cut(s)	26, 42, 63, 84, 102, 118, 138, 158, 160
SinI	GGWCC	1 cut(s)	109
Sse9I	AATT	2 cut(s)	76, 175
SspI	AATATT	1 cut(s)	139
SspMI	CTAG	2 cut(s)	90, 126
TasI	AATT	2 cut(s)	76, 175
TscAI	CASTG	1 cut(s)	21
TspRI	CASTG	1 cut(s)	21
VpaK11BI	GGWCC	1 cut(s)	109
XbaI	TCTAGA	1 cut(s)	89
XspI	CTAG	2 cut(s)	90, 126

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.