MD08G1212400.v1.1

specification of plant organ axis polarity

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr08
Physical Location & Seq
Forward (+)
27609033 .. 27610067
1035 bp
Loading structure...
UTR
Exon/CDS
Intron
MD08G1212400.v1.1.491

Sequence Viewer

Length: 285 bp
ATGCAAGAAATTACAATTGAAAAAGCCATGTGTAATGAGCAGAAATGTATCACCACTATGAAAGGGCTGCAGCTTTTTGATATTGAAACATGCATAAATTCACCTGGAAATTATTCATGTCAATGTCTTAAAGGATGCAAACATGAAGGCATGGATGAAAAGAGTTGTATCAAAGACAACAAACTGTCAAATGCCATTCTCCTCATTATTTCATTAGGTTGGCATCGCCGTCACATTGATATGAAGCTGCTGCGGAGGCGGAGTTGCTGTTTTGGGGGAAGATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

95

Amino Acids

10.78

Weight (kDa)

8.79

Isoelectric Point (pI)

80.01

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0024393)

Species Orthologous Gene IDs
malus_domestica MD08G1212400.v1.1
pyrus_communis pycom10g20720 pycom15g26900

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 253, 259
AcsI RAATTY 1 cut(s) 97
AgsI TTSAA 2 cut(s) 20, 86
AjnI CCWGG 1 cut(s) 103
AluBI AGCT 2 cut(s) 73, 247
AluI AGCT 2 cut(s) 73, 247
ApeKI GCWGC 4 cut(s) 67, 70, 247, 250
ApoI RAATTY 1 cut(s) 97
Asp700I GAANNNNTTC 1 cut(s) 112
AsuHPI GGTGA 2 cut(s) 43, 93
BbvI GCAGC 4 cut(s) 54, 82, 234, 237
BceAI ACGGC 1 cut(s) 213
BciT130I CCWGG 1 cut(s) 105
BfmI CTRYAG 1 cut(s) 68
BisI GCNGC 4 cut(s) 68, 71, 248, 251
BlsI GCNGC 4 cut(s) 69, 72, 249, 252
Bme1390I CCNGG 1 cut(s) 105
BmrFI CCNGG 1 cut(s) 105
BmsI GCATC 2 cut(s) 125, 232
BsaXI ACNNNNNCTCC 4 cut(s) 247, 253, 277, 283
BseBI CCWGG 1 cut(s) 105
BseGI GGATG 2 cut(s) 140, 160
BseRI GAGGAG 1 cut(s) 191
BseXI GCAGC 4 cut(s) 54, 82, 234, 237
BspACI CCGC 2 cut(s) 253, 259
BspMAI CTGCAG 1 cut(s) 72
Bst2UI CCWGG 1 cut(s) 105
Bst4CI ACNGT 1 cut(s) 186
BstF5I GGATG 2 cut(s) 140, 160
BstMWI GCNNNNNNNGC 1 cut(s) 256
BstNI CCWGG 1 cut(s) 105
BstNSI RCATGY 1 cut(s) 93
BstSCI CCNGG 1 cut(s) 103
BstSFI CTRYAG 1 cut(s) 68
BstV1I GCAGC 4 cut(s) 54, 82, 234, 237
BtgZI GCGATG 1 cut(s) 209
BtsCI GGATG 2 cut(s) 140, 160
CviAII CATG 5 cut(s) 28, 90, 117, 143, 151
CviJI RGCY 4 cut(s) 26, 67, 73, 247
CviKI_1 RGCY 4 cut(s) 26, 67, 73, 247
EciI GGCGGA 1 cut(s) 274
EcoRII CCWGG 1 cut(s) 103
EcoT22I ATGCAT 1 cut(s) 95
FaeI CATG 5 cut(s) 31, 93, 120, 146, 154
FaiI YATR 8 cut(s) 29, 59, 91, 95, 118, 144, 152, 242
FatI CATG 5 cut(s) 27, 89, 116, 142, 150
Fnu4HI GCNGC 4 cut(s) 68, 71, 248, 251
FokI GGATG 2 cut(s) 147, 167
Fsp4HI GCNGC 4 cut(s) 68, 71, 248, 251
GluI GCNGC 4 cut(s) 68, 71, 248, 251
Hin1II CATG 5 cut(s) 31, 93, 120, 146, 154
HphI GGTGA 2 cut(s) 43, 93
HpyAV CCTTC 1 cut(s) 140
HpyCH4III ACNGT 1 cut(s) 186
HpyCH4V TGCA 4 cut(s) 4, 70, 93, 138
HpyF10VI GCNNNNNNNGC 1 cut(s) 256
Hsp92II CATG 5 cut(s) 31, 93, 120, 146, 154
LpnPI CCDG 2 cut(s) 90, 117
Lsp1109I GCAGC 4 cut(s) 54, 82, 234, 237
LweI GCATC 2 cut(s) 125, 232
MaeIII GTNAC 1 cut(s) 230
MfeI CAATTG 1 cut(s) 15
MluCI AATT 4 cut(s) 9, 15, 97, 109
MnlI CCTC 2 cut(s) 212, 249
Mph1103I ATGCAT 1 cut(s) 95
MroXI GAANNNNTTC 1 cut(s) 112
MseI TTAA 1 cut(s) 129
MslI CAYNNNNRTG 3 cut(s) 56, 121, 239
MspR9I CCNGG 1 cut(s) 105
MunI CAATTG 1 cut(s) 15
MvaI CCWGG 1 cut(s) 105
MwoI GCNNNNNNNGC 1 cut(s) 256
NlaIII CATG 5 cut(s) 31, 93, 120, 146, 154
NmuCI GTSAC 1 cut(s) 230
NsiI ATGCAT 1 cut(s) 95
NspI RCATGY 1 cut(s) 93
PdmI GAANNNNTTC 1 cut(s) 112
PkrI GCNGC 4 cut(s) 69, 72, 249, 252
Psp6I CCWGG 1 cut(s) 103
PspGI CCWGG 1 cut(s) 103
PstI CTGCAG 1 cut(s) 72
RseI CAYNNNNRTG 3 cut(s) 56, 121, 239
SaqAI TTAA 1 cut(s) 129
SatI GCNGC 4 cut(s) 68, 71, 248, 251
ScrFI CCNGG 1 cut(s) 105
SetI ASST 4 cut(s) 75, 106, 220, 249
SfaNI GCATC 2 cut(s) 125, 232
SfcI CTRYAG 1 cut(s) 68
SgeI CNNG 8 cut(s) 17, 40, 102, 116, 117, 129, 155, 163
SmiMI CAYNNNNRTG 3 cut(s) 56, 121, 239
Sse9I AATT 4 cut(s) 9, 15, 97, 109
SsiI CCGC 2 cut(s) 253, 259
StyD4I CCNGG 1 cut(s) 103
TaaI ACNGT 1 cut(s) 186
TasI AATT 4 cut(s) 9, 15, 97, 109
Tru1I TTAA 1 cut(s) 129
Tru9I TTAA 1 cut(s) 129
TseFI GTSAC 1 cut(s) 230
TseI GCWGC 4 cut(s) 67, 70, 247, 250
Tsp45I GTSAC 1 cut(s) 230
TspDTI ATGAA 6 cut(s) 74, 105, 159, 171, 201, 257
XapI RAATTY 1 cut(s) 97
XceI RCATGY 1 cut(s) 93
XmnI GAANNNNTTC 1 cut(s) 112
Zsp2I ATGCAT 1 cut(s) 95
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.