pycom15g26900

specification of plant organ axis polarity

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr15
Physical Location & Seq
Forward (+)
22151655 .. 22151903
249 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom15g26900.1

Sequence Viewer

Length: 249 bp
ATGGTTCCTTACTTTCCAGATATTGAAACATGCATAAATTCACCTGGAAATTATTCATGTCAATGTCCCAAAGGATACAAACATGAAGGCATGGATGAAAAGAGTTGTATCAAAGACAACAAATGGTCAAAGGCCATTCTCCTCATTATTTCATTAGGGATGCATGTTTTTTTTCTCATGTTAATATATTGCATATACAAGCCTAAATTTATTTTATTGGAGCCACTTTTGGATCCAAAATTCTCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

83

Amino Acids

9.51

Weight (kDa)

7.6

Isoelectric Point (pI)

44.69

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
EGF_CA PF07645 9 - 36 5.8e-06 Calcium-binding EGF domain
FXa_inhibition PF14670 10 - 36 1.3e-06 Coagulation Factor Xa inhibitory site
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0024393)

Species Orthologous Gene IDs
malus_domestica MD08G1212400.v1.1
pyrus_communis pycom10g20720 pycom15g26900

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 227, 240
AcsI RAATTY 3 cut(s) 37, 206, 239
AgsI TTSAA 1 cut(s) 26
AjnI CCWGG 1 cut(s) 43
AlwI GGATC 2 cut(s) 227, 240
AoxI GGCC 1 cut(s) 132
ApoI RAATTY 3 cut(s) 37, 206, 239
Asp700I GAANNNNTTC 1 cut(s) 52
AsuHPI GGTGA 1 cut(s) 33
BamHI GGATCC 1 cut(s) 232
BciT130I CCWGG 1 cut(s) 45
BciVI GTATCC 1 cut(s) 68
BfuI GTATCC 1 cut(s) 68
Bme1390I CCNGG 1 cut(s) 45
BmiI GGNNCC 3 cut(s) 6, 222, 234
BmrFI CCNGG 1 cut(s) 45
BmsI GCATC 1 cut(s) 150
BseBI CCWGG 1 cut(s) 45
BseGI GGATG 2 cut(s) 100, 165
BseRI GAGGAG 1 cut(s) 131
BshFI GGCC 1 cut(s) 134
BslFI GGGAC 1 cut(s) 51
BsmFI GGGAC 1 cut(s) 51
BsnI GGCC 1 cut(s) 134
Bsp143I GATC 1 cut(s) 232
BspANI GGCC 1 cut(s) 134
BspLI GGNNCC 3 cut(s) 6, 222, 234
BspPI GGATC 2 cut(s) 227, 240
BssMI GATC 1 cut(s) 232
Bst2UI CCWGG 1 cut(s) 45
BstF5I GGATG 2 cut(s) 100, 165
BstKTI GATC 1 cut(s) 235
BstMBI GATC 1 cut(s) 232
BstNI CCWGG 1 cut(s) 45
BstNSI RCATGY 2 cut(s) 33, 167
BstSCI CCNGG 1 cut(s) 43
BstX2I RGATCY 1 cut(s) 232
BstYI RGATCY 1 cut(s) 232
BsuI GTATCC 1 cut(s) 68
BsuRI GGCC 1 cut(s) 134
BtsCI GGATG 2 cut(s) 100, 165
CviAII CATG 6 cut(s) 30, 57, 83, 91, 164, 178
CviJI RGCY 3 cut(s) 134, 202, 223
CviKI_1 RGCY 3 cut(s) 134, 202, 223
DpnI GATC 1 cut(s) 234
DpnII GATC 1 cut(s) 232
EcoRII CCWGG 1 cut(s) 43
EcoT22I ATGCAT 2 cut(s) 35, 165
FaeI CATG 6 cut(s) 33, 60, 86, 94, 167, 181
FaqI GGGAC 1 cut(s) 51
FatI CATG 6 cut(s) 29, 56, 82, 90, 163, 177
FokI GGATG 2 cut(s) 107, 172
HaeIII GGCC 1 cut(s) 134
Hin1II CATG 6 cut(s) 33, 60, 86, 94, 167, 181
HphI GGTGA 1 cut(s) 33
Hpy188III TCNNGA 1 cut(s) 17
HpyAV CCTTC 1 cut(s) 80
HpyCH4V TGCA 3 cut(s) 33, 163, 192
Hsp92II CATG 6 cut(s) 33, 60, 86, 94, 167, 181
Kzo9I GATC 1 cut(s) 232
LmnI GCTCC 1 cut(s) 220
LpnPI CCDG 3 cut(s) 30, 30, 57
LweI GCATC 1 cut(s) 150
MalI GATC 1 cut(s) 234
MboI GATC 1 cut(s) 232
MflI RGATCY 1 cut(s) 232
MluCI AATT 4 cut(s) 37, 49, 206, 239
MnlI CCTC 1 cut(s) 152
Mph1103I ATGCAT 2 cut(s) 35, 165
MroXI GAANNNNTTC 1 cut(s) 52
MseI TTAA 1 cut(s) 182
MslI CAYNNNNRTG 1 cut(s) 61
MspR9I CCNGG 1 cut(s) 45
MvaI CCWGG 1 cut(s) 45
NdeII GATC 1 cut(s) 232
NlaIII CATG 6 cut(s) 33, 60, 86, 94, 167, 181
NlaIV GGNNCC 3 cut(s) 6, 222, 234
NsiI ATGCAT 2 cut(s) 35, 165
NspI RCATGY 2 cut(s) 33, 167
PdmI GAANNNNTTC 1 cut(s) 52
Psp6I CCWGG 1 cut(s) 43
PspGI CCWGG 1 cut(s) 43
PspN4I GGNNCC 3 cut(s) 6, 222, 234
PsuI RGATCY 1 cut(s) 232
RseI CAYNNNNRTG 1 cut(s) 61
SaqAI TTAA 1 cut(s) 182
Sau3AI GATC 1 cut(s) 232
ScrFI CCNGG 1 cut(s) 45
SetI ASST 1 cut(s) 46
SfaNI GCATC 1 cut(s) 150
SmiMI CAYNNNNRTG 1 cut(s) 61
Sse9I AATT 4 cut(s) 37, 49, 206, 239
StyD4I CCNGG 1 cut(s) 43
TasI AATT 4 cut(s) 37, 49, 206, 239
Tru1I TTAA 1 cut(s) 182
Tru9I TTAA 1 cut(s) 182
TspDTI ATGAA 4 cut(s) 45, 99, 111, 141
XapI RAATTY 3 cut(s) 37, 206, 239
XceI RCATGY 2 cut(s) 33, 167
XmnI GAANNNNTTC 1 cut(s) 52
Zsp2I ATGCAT 2 cut(s) 35, 165
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.