MD09G1241700.v1.1

sucrose synthase activity

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr09
Physical Location & Seq
Forward (+)
30895927 .. 30899424
3498 bp
Loading structure...
UTR
Exon/CDS
Intron
MD09G1241700.v1.1.491

Sequence Viewer

Length: 219 bp
ATGAGCTTCCCGCATTATCAGCATCTACTGCTCCAGGTCGAACACCGCAGAGGTCGATGCATTGAAGGAGGAAGTGACAACCCTAAAGGGTTAGCTTGCGGTCCAGGGCCAACAAATGATGGCCCAGGGCGAGGAGCTGAAGGCTTGTGTTGGGCACGTGAGAGACCTTGTAAGAACCATACAGATGATCGGCATCCAAATCTCGCTACCAGTACCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

73

Amino Acids

7.87

Weight (kDa)

7.76

Isoelectric Point (pI)

44.86

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0022353)

Species Orthologous Gene IDs
malus_domestica MD03G1148200.v1.1 MD09G1241700.v1.1
pyrus_communis pycom08g08290 pycom09g13240

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 3 cut(s) 11, 46, 99
AcuI CTGAAG 1 cut(s) 159
AcvI CACGTG 1 cut(s) 158
AfaI GTAC 1 cut(s) 214
AfiI CCNNNNNNNGG 1 cut(s) 131
AgsI TTSAA 1 cut(s) 65
AjnI CCWGG 3 cut(s) 33, 103, 124
AluBI AGCT 3 cut(s) 6, 95, 137
AluI AGCT 3 cut(s) 6, 95, 137
Alw26I GTCTC 1 cut(s) 157
AlwNI CAGNNNCTG 1 cut(s) 216
AoxI GGCC 2 cut(s) 107, 121
AspS9I GGNCC 3 cut(s) 101, 107, 122
AvaII GGWCC 1 cut(s) 101
BaeGI GKGCMC 1 cut(s) 157
BbrPI CACGTG 1 cut(s) 158
BccI CCATC 1 cut(s) 113
BciT130I CCWGG 3 cut(s) 35, 105, 126
BcoDI GTCTC 1 cut(s) 157
Bme1390I CCNGG 3 cut(s) 35, 105, 126
Bme18I GGWCC 1 cut(s) 101
BmgT120I GGNCC 3 cut(s) 101, 107, 122
BmrFI CCNGG 3 cut(s) 35, 105, 126
BmsI GCATC 3 cut(s) 31, 47, 202
BpmI CTGGAG 1 cut(s) 17
BsaAI YACGTR 1 cut(s) 158
BsaBI GATNNNNATC 1 cut(s) 192
BsaI GGTCTC 1 cut(s) 157
BsaJI CCNNGG 3 cut(s) 104, 124, 125
Bsc4I CCNNNNNNNGG 1 cut(s) 131
Bse1I ACTGG 1 cut(s) 210
Bse8I GATNNNNATC 1 cut(s) 192
BseBI CCWGG 3 cut(s) 35, 105, 126
BseDI CCNNGG 3 cut(s) 104, 124, 125
BseGI GGATG 1 cut(s) 193
BseJI GATNNNNATC 1 cut(s) 192
BseLI CCNNNNNNNGG 1 cut(s) 131
BseNI ACTGG 1 cut(s) 210
BseRI GAGGAG 1 cut(s) 147
BseSI GKGCMC 1 cut(s) 157
BshFI GGCC 2 cut(s) 109, 123
BslI CCNNNNNNNGG 1 cut(s) 131
BsmAI GTCTC 1 cut(s) 157
BsnI GGCC 2 cut(s) 109, 123
Bso31I GGTCTC 1 cut(s) 157
Bsp1286I GDGCHC 1 cut(s) 157
Bsp143I GATC 1 cut(s) 187
BspACI CCGC 3 cut(s) 11, 46, 99
BspANI GGCC 2 cut(s) 109, 123
BspTNI GGTCTC 1 cut(s) 157
BsrI ACTGG 1 cut(s) 210
BssECI CCNNGG 3 cut(s) 104, 124, 125
BssMI GATC 1 cut(s) 187
Bst2UI CCWGG 3 cut(s) 35, 105, 126
BstAPI GCANNNNNTGC 1 cut(s) 28
BstBAI YACGTR 1 cut(s) 158
BstC8I GCNNGC 1 cut(s) 97
BstF5I GGATG 1 cut(s) 193
BstKTI GATC 1 cut(s) 190
BstMAI GTCTC 1 cut(s) 157
BstMBI GATC 1 cut(s) 187
BstMWI GCNNNNNNNGC 2 cut(s) 19, 28
BstNI CCWGG 3 cut(s) 35, 105, 126
BstSCI CCNGG 3 cut(s) 33, 103, 124
BstSLI GKGCMC 1 cut(s) 157
BsuRI GGCC 2 cut(s) 109, 123
BtsCI GGATG 1 cut(s) 193
Cac8I GCNNGC 1 cut(s) 97
CaiI CAGNNNCTG 1 cut(s) 216
Cfr13I GGNCC 3 cut(s) 101, 107, 122
Csp6I GTAC 1 cut(s) 213
CviJI RGCY 6 cut(s) 6, 95, 109, 123, 137, 144
CviKI_1 RGCY 6 cut(s) 6, 95, 109, 123, 137, 144
CviQI GTAC 1 cut(s) 213
DpnI GATC 1 cut(s) 189
DpnII GATC 1 cut(s) 187
Eco31I GGTCTC 1 cut(s) 157
Eco47I GGWCC 1 cut(s) 101
Eco57I CTGAAG 1 cut(s) 159
Eco72I CACGTG 1 cut(s) 158
EcoRII CCWGG 3 cut(s) 33, 103, 124
EcoT22I ATGCAT 1 cut(s) 62
FaiI YATR 1 cut(s) 180
FauI CCCGC 1 cut(s) 18
FokI GGATG 1 cut(s) 180
GsuI CTGGAG 1 cut(s) 17
HaeIII GGCC 2 cut(s) 109, 123
HpyAV CCTTC 2 cut(s) 59, 134
HpyCH4IV ACGT 1 cut(s) 157
HpyCH4V TGCA 1 cut(s) 60
HpyF10VI GCNNNNNNNGC 2 cut(s) 19, 28
HpySE526I ACGT 1 cut(s) 157
Kzo9I GATC 1 cut(s) 187
LmnI GCTCC 2 cut(s) 36, 134
LpnPI CCDG 6 cut(s) 20, 47, 90, 111, 117, 138
LweI GCATC 3 cut(s) 31, 47, 202
MaeII ACGT 1 cut(s) 157
MaeIII GTNAC 1 cut(s) 74
MalI GATC 1 cut(s) 189
MboI GATC 1 cut(s) 187
MhlI GDGCHC 1 cut(s) 157
MnlI CCTC 3 cut(s) 44, 62, 125
Mph1103I ATGCAT 1 cut(s) 62
MslI CAYNNNNRTG 1 cut(s) 183
MspR9I CCNGG 3 cut(s) 35, 105, 126
MvaI CCWGG 3 cut(s) 35, 105, 126
MwoI GCNNNNNNNGC 2 cut(s) 19, 28
NdeII GATC 1 cut(s) 187
NmuCI GTSAC 1 cut(s) 74
NsiI ATGCAT 1 cut(s) 62
PasI CCCWGGG 1 cut(s) 125
PmaCI CACGTG 1 cut(s) 158
PmlI CACGTG 1 cut(s) 158
Ppu21I YACGTR 1 cut(s) 158
Psp6I CCWGG 3 cut(s) 33, 103, 124
PspCI CACGTG 1 cut(s) 158
PspGI CCWGG 3 cut(s) 33, 103, 124
PspPI GGNCC 3 cut(s) 101, 107, 122
PstNI CAGNNNCTG 1 cut(s) 216
RsaI GTAC 1 cut(s) 214
RsaNI GTAC 1 cut(s) 213
RseI CAYNNNNRTG 1 cut(s) 183
Sau3AI GATC 1 cut(s) 187
Sau96I GGNCC 3 cut(s) 101, 107, 122
ScrFI CCNGG 3 cut(s) 35, 105, 126
SduI GDGCHC 1 cut(s) 157
SetI ASST 8 cut(s) 8, 39, 55, 97, 139, 160, 169, 218
SfaNI GCATC 3 cut(s) 31, 47, 202
SinI GGWCC 1 cut(s) 101
SmiMI CAYNNNNRTG 1 cut(s) 183
SsiI CCGC 3 cut(s) 11, 46, 99
StyD4I CCNGG 3 cut(s) 33, 103, 124
TaiI ACGT 1 cut(s) 160
TaqI TCGA 2 cut(s) 39, 55
TseFI GTSAC 1 cut(s) 74
Tsp45I GTSAC 1 cut(s) 74
VpaK11BI GGWCC 1 cut(s) 101
Zsp2I ATGCAT 1 cut(s) 62
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.