pycom09g13240

sucrose synthase activity

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr9
Physical Location & Seq
Reverse (-)
11898439 .. 11898657
219 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom09g13240.1

Sequence Viewer

Length: 219 bp
ATGAGCTTCCTGCATTATCAGCATCTACTGCTCCAGGTCGAACACCGCAGAGGTCGATGCATTGAAGGAGGAAATGACAACCCTAAAGGGTCAGCTTGCGGTCCAGGGCCAGCAGATGAGGACCTAAGGCGAGGAGCTGAAGGCCTGTATTGGGCACGTGAGAGACCTTGTACGAGCCATACAGTTGATCGGCATCCAAATCTCGCTACCAGCACCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

73

Amino Acids

8.04

Weight (kDa)

6.95

Isoelectric Point (pI)

55.6

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0022353)

Species Orthologous Gene IDs
malus_domestica MD03G1148200.v1.1 MD09G1241700.v1.1
pyrus_communis pycom08g08290 pycom09g13240

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 46, 99
AcuI CTGAAG 1 cut(s) 159
AcvI CACGTG 1 cut(s) 158
AfaI GTAC 1 cut(s) 172
AfiI CCNNNNNNNGG 1 cut(s) 151
AgsI TTSAA 1 cut(s) 65
AjnI CCWGG 2 cut(s) 33, 103
AluBI AGCT 3 cut(s) 6, 95, 137
AluI AGCT 3 cut(s) 6, 95, 137
Alw26I GTCTC 1 cut(s) 157
AlwNI CAGNNNCTG 1 cut(s) 216
AoxI GGCC 2 cut(s) 107, 142
AspS9I GGNCC 3 cut(s) 101, 107, 121
AvaII GGWCC 2 cut(s) 101, 121
AxyI CCTNAGG 1 cut(s) 125
BaeGI GKGCMC 1 cut(s) 157
BbrPI CACGTG 1 cut(s) 158
BciT130I CCWGG 2 cut(s) 35, 105
BcoDI GTCTC 1 cut(s) 157
Bme1390I CCNGG 2 cut(s) 35, 105
Bme18I GGWCC 2 cut(s) 101, 121
BmgT120I GGNCC 3 cut(s) 101, 107, 121
BmrFI CCNGG 2 cut(s) 35, 105
BmsI GCATC 3 cut(s) 31, 47, 202
BpmI CTGGAG 1 cut(s) 17
BsaAI YACGTR 1 cut(s) 158
BsaBI GATNNNNATC 1 cut(s) 192
BsaI GGTCTC 1 cut(s) 157
BsaJI CCNNGG 1 cut(s) 104
Bsc4I CCNNNNNNNGG 1 cut(s) 151
Bse21I CCTNAGG 1 cut(s) 125
Bse8I GATNNNNATC 1 cut(s) 192
BseBI CCWGG 2 cut(s) 35, 105
BseDI CCNNGG 1 cut(s) 104
BseGI GGATG 1 cut(s) 193
BseJI GATNNNNATC 1 cut(s) 192
BseLI CCNNNNNNNGG 1 cut(s) 151
BseRI GAGGAG 1 cut(s) 147
BseSI GKGCMC 1 cut(s) 157
BshFI GGCC 2 cut(s) 109, 144
BslI CCNNNNNNNGG 1 cut(s) 151
BsmAI GTCTC 1 cut(s) 157
BsnI GGCC 2 cut(s) 109, 144
Bso31I GGTCTC 1 cut(s) 157
Bsp1286I GDGCHC 1 cut(s) 157
Bsp143I GATC 1 cut(s) 187
BspACI CCGC 2 cut(s) 46, 99
BspANI GGCC 2 cut(s) 109, 144
BspTNI GGTCTC 1 cut(s) 157
BssECI CCNNGG 1 cut(s) 104
BssMI GATC 1 cut(s) 187
Bst2UI CCWGG 2 cut(s) 35, 105
Bst4CI ACNGT 1 cut(s) 184
BstAPI GCANNNNNTGC 1 cut(s) 28
BstBAI YACGTR 1 cut(s) 158
BstC8I GCNNGC 2 cut(s) 97, 111
BstDEI CTNAG 1 cut(s) 125
BstF5I GGATG 1 cut(s) 193
BstKTI GATC 1 cut(s) 190
BstMAI GTCTC 1 cut(s) 157
BstMBI GATC 1 cut(s) 187
BstMWI GCNNNNNNNGC 2 cut(s) 19, 28
BstNI CCWGG 2 cut(s) 35, 105
BstSCI CCNGG 2 cut(s) 33, 103
BstSLI GKGCMC 1 cut(s) 157
Bsu36I CCTNAGG 1 cut(s) 125
BsuRI GGCC 2 cut(s) 109, 144
BtsCI GGATG 1 cut(s) 193
Cac8I GCNNGC 2 cut(s) 97, 111
CaiI CAGNNNCTG 1 cut(s) 216
Cfr13I GGNCC 3 cut(s) 101, 107, 121
Csp6I GTAC 1 cut(s) 171
CviJI RGCY 6 cut(s) 6, 95, 109, 137, 144, 177
CviKI_1 RGCY 6 cut(s) 6, 95, 109, 137, 144, 177
CviQI GTAC 1 cut(s) 171
DdeI CTNAG 1 cut(s) 125
DpnI GATC 1 cut(s) 189
DpnII GATC 1 cut(s) 187
Eco147I AGGCCT 1 cut(s) 144
Eco31I GGTCTC 1 cut(s) 157
Eco47I GGWCC 2 cut(s) 101, 121
Eco57I CTGAAG 1 cut(s) 159
Eco72I CACGTG 1 cut(s) 158
Eco81I CCTNAGG 1 cut(s) 125
EcoO109I RGGNCCY 1 cut(s) 121
EcoRII CCWGG 2 cut(s) 33, 103
EcoT22I ATGCAT 1 cut(s) 62
FaiI YATR 1 cut(s) 180
FokI GGATG 1 cut(s) 180
GsuI CTGGAG 1 cut(s) 17
HaeIII GGCC 2 cut(s) 109, 144
HpyAV CCTTC 2 cut(s) 59, 134
HpyCH4III ACNGT 1 cut(s) 184
HpyCH4IV ACGT 1 cut(s) 157
HpyCH4V TGCA 2 cut(s) 13, 60
HpyF10VI GCNNNNNNNGC 2 cut(s) 19, 28
HpyF3I CTNAG 1 cut(s) 125
HpySE526I ACGT 1 cut(s) 157
Kzo9I GATC 1 cut(s) 187
LmnI GCTCC 2 cut(s) 36, 134
LpnPI CCDG 7 cut(s) 20, 23, 47, 90, 117, 123, 158
LweI GCATC 3 cut(s) 31, 47, 202
MaeII ACGT 1 cut(s) 157
MalI GATC 1 cut(s) 189
MboI GATC 1 cut(s) 187
MhlI GDGCHC 1 cut(s) 157
MnlI CCTC 4 cut(s) 44, 62, 112, 125
Mph1103I ATGCAT 1 cut(s) 62
MspR9I CCNGG 2 cut(s) 35, 105
MvaI CCWGG 2 cut(s) 35, 105
MwoI GCNNNNNNNGC 2 cut(s) 19, 28
NdeII GATC 1 cut(s) 187
NsiI ATGCAT 1 cut(s) 62
PceI AGGCCT 1 cut(s) 144
PmaCI CACGTG 1 cut(s) 158
PmlI CACGTG 1 cut(s) 158
Ppu21I YACGTR 1 cut(s) 158
PpuMI RGGWCCY 1 cut(s) 121
Psp5II RGGWCCY 1 cut(s) 121
Psp6I CCWGG 2 cut(s) 33, 103
PspCI CACGTG 1 cut(s) 158
PspGI CCWGG 2 cut(s) 33, 103
PspPI GGNCC 3 cut(s) 101, 107, 121
PspPPI RGGWCCY 1 cut(s) 121
PstNI CAGNNNCTG 1 cut(s) 216
RsaI GTAC 1 cut(s) 172
RsaNI GTAC 1 cut(s) 171
Sau3AI GATC 1 cut(s) 187
Sau96I GGNCC 3 cut(s) 101, 107, 121
ScrFI CCNGG 2 cut(s) 35, 105
SduI GDGCHC 1 cut(s) 157
SetI ASST 9 cut(s) 8, 39, 55, 97, 126, 139, 160, 169, 218
SfaNI GCATC 3 cut(s) 31, 47, 202
SinI GGWCC 2 cut(s) 101, 121
SseBI AGGCCT 1 cut(s) 144
SsiI CCGC 2 cut(s) 46, 99
StuI AGGCCT 1 cut(s) 144
StyD4I CCNGG 2 cut(s) 33, 103
TaaI ACNGT 1 cut(s) 184
TaiI ACGT 1 cut(s) 160
TaqI TCGA 2 cut(s) 39, 55
VpaK11BI GGWCC 2 cut(s) 101, 121
Zsp2I ATGCAT 1 cut(s) 62
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.