MD10G1135000.v1.1

No description available

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr10
Physical Location & Seq
Forward (+)
21797581 .. 21798640
1060 bp
Loading structure...
UTR
Exon/CDS
Intron
MD10G1135000.v1.1.491

Sequence Viewer

Length: 147 bp
ATGCTGATTTTATTTTTTAATTTTTGGTTTTTCCTTGATTGGCTAGGGAATTACAACCAAATGATGAATCTTCAGTTTACTTGGTGGATTCTCAAGAGGGGCTTCAATGTACAGAAGAATTACAAGACATCATTGGAAGATGGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

49

Amino Acids

6.06

Weight (kDa)

8.14

Isoelectric Point (pI)

22.67

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0021886)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G57390
malus_domestica MD10G1135000.v1.1 MD14G1046900.v1.1
pyrus_communis pycom06g12560

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 56
AfaI GTAC 1 cut(s) 111
AgsI TTSAA 1 cut(s) 106
BccI CCATC 1 cut(s) 134
BfaI CTAG 2 cut(s) 44, 145
BpuEI CTTGAG 1 cut(s) 77
Bsp1407I TGTACA 1 cut(s) 109
BsrGI TGTACA 1 cut(s) 109
BstAUI TGTACA 1 cut(s) 109
Csp6I GTAC 1 cut(s) 110
CviJI RGCY 3 cut(s) 43, 102, 144
CviKI_1 RGCY 3 cut(s) 43, 102, 144
CviQI GTAC 1 cut(s) 110
Eco57I CTGAAG 1 cut(s) 56
FalI AAGNNNNNCTT 2 cut(s) 86, 118
FspBI CTAG 2 cut(s) 44, 145
HinfI GANTC 2 cut(s) 67, 88
Hpy166II GTNNAC 1 cut(s) 78
Hpy188III TCNNGA 1 cut(s) 94
Hpy8I GTNNAC 1 cut(s) 78
MaeI CTAG 2 cut(s) 44, 145
MboII GAAGA 2 cut(s) 62, 127
MluCI AATT 3 cut(s) 19, 49, 118
MnlI CCTC 1 cut(s) 90
MseI TTAA 1 cut(s) 18
PfeI GAWTC 2 cut(s) 67, 88
RsaI GTAC 1 cut(s) 111
RsaNI GTAC 1 cut(s) 110
SaqAI TTAA 1 cut(s) 18
SgeI CNNG 5 cut(s) 47, 56, 93, 106, 136
SmlI CTYRAG 1 cut(s) 92
SmoI CTYRAG 1 cut(s) 92
Sse9I AATT 3 cut(s) 19, 49, 118
SspMI CTAG 2 cut(s) 44, 145
TasI AATT 3 cut(s) 19, 49, 118
TatI WGTACW 1 cut(s) 109
TfiI GAWTC 2 cut(s) 67, 88
Tru1I TTAA 1 cut(s) 18
Tru9I TTAA 1 cut(s) 18
TspDTI ATGAA 1 cut(s) 80
XspI CTAG 2 cut(s) 44, 145
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.