MD14G1046900.v1.1

No description available

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr14
Physical Location & Seq
Reverse (-)
4469972 .. 4471106
1135 bp
Loading structure...
UTR
Exon/CDS
Intron
MD14G1046900.v1.1.491

Sequence Viewer

Length: 135 bp
ATGTTCAGTGGATTTGGGGAGAGGGTGGCCAATCATTTGAAAAAAAAAACTCAGGAAAAGCAGTGGATTCTTAAGAGGGGCTTCAATGTACAGAAGAATTATAAGGTCTTATTAGCTATTCATTATTTTATATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

45

Amino Acids

5.31

Weight (kDa)

10.29

Isoelectric Point (pI)

32.95

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0021886)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G57390
malus_domestica MD10G1135000.v1.1 MD14G1046900.v1.1
pyrus_communis pycom06g12560

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 102
AcoI YGGCCR 1 cut(s) 27
AfaI GTAC 1 cut(s) 90
AflII CTTAAG 1 cut(s) 71
AgsI TTSAA 2 cut(s) 40, 85
AluBI AGCT 1 cut(s) 116
AluI AGCT 1 cut(s) 116
AoxI GGCC 1 cut(s) 27
BalI TGGCCA 1 cut(s) 29
BfrI CTTAAG 1 cut(s) 71
BseMII CTCAG 1 cut(s) 65
BshFI GGCC 1 cut(s) 29
BsnI GGCC 1 cut(s) 29
Bsp1407I TGTACA 1 cut(s) 88
BspANI GGCC 1 cut(s) 29
BspCNI CTCAG 1 cut(s) 64
BspTI CTTAAG 1 cut(s) 71
BsrGI TGTACA 1 cut(s) 88
BstAFI CTTAAG 1 cut(s) 71
BstAUI TGTACA 1 cut(s) 88
BstDEI CTNAG 1 cut(s) 51
BsuRI GGCC 1 cut(s) 29
BtsI GCAGTG 1 cut(s) 68
BtsIMutI CAGTG 2 cut(s) 13, 68
Csp6I GTAC 1 cut(s) 89
CviJI RGCY 3 cut(s) 29, 81, 116
CviKI_1 RGCY 3 cut(s) 29, 81, 116
CviQI GTAC 1 cut(s) 89
DdeI CTNAG 1 cut(s) 51
EaeI YGGCCR 1 cut(s) 27
FaiI YATR 3 cut(s) 102, 131, 133
FalI AAGNNNNNCTT 2 cut(s) 65, 97
HaeIII GGCC 1 cut(s) 29
HinfI GANTC 1 cut(s) 67
Hpy188III TCNNGA 1 cut(s) 53
HpyF3I CTNAG 1 cut(s) 51
LpnPI CCDG 1 cut(s) 38
MboII GAAGA 1 cut(s) 106
MlsI TGGCCA 1 cut(s) 29
MluCI AATT 1 cut(s) 97
MluNI TGGCCA 1 cut(s) 29
MnlI CCTC 2 cut(s) 15, 69
Mox20I TGGCCA 1 cut(s) 29
MscI TGGCCA 1 cut(s) 29
MseI TTAA 1 cut(s) 72
Msp20I TGGCCA 1 cut(s) 29
MspCI CTTAAG 1 cut(s) 71
PfeI GAWTC 1 cut(s) 67
PsiI TTATAA 1 cut(s) 102
RsaI GTAC 1 cut(s) 90
RsaNI GTAC 1 cut(s) 89
SaqAI TTAA 1 cut(s) 72
SetI ASST 2 cut(s) 108, 118
SgeI CNNG 1 cut(s) 65
SmlI CTYRAG 1 cut(s) 71
SmoI CTYRAG 1 cut(s) 71
Sse9I AATT 1 cut(s) 97
TasI AATT 1 cut(s) 97
TatI WGTACW 1 cut(s) 88
TfiI GAWTC 1 cut(s) 67
Tru1I TTAA 1 cut(s) 72
Tru9I TTAA 1 cut(s) 72
TscAI CASTG 2 cut(s) 13, 68
TspDTI ATGAA 1 cut(s) 110
TspRI CASTG 2 cut(s) 13, 68
Vha464I CTTAAG 1 cut(s) 71
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.