MD10G1135100.v1.1

NmrA-like family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr10
OG0022280
Physical Location & Seq
Reverse (-)
21799371 .. 21800660
1290 bp
Loading structure...
UTR
Exon/CDS
Intron
MD10G1135100.v1.1.491

Sequence Viewer

Length: 141 bp
ATGTATAAATCAGTATGGGGAACAGATGCCCCCACAAGAATTGCATACGTGGACACCCAGGTTCATCATGCATTGACCGTTTCCCTGGTTGATTTTAGATATATACTAGAAAGTAAAGTTCGGGCGATGCTGCGGGTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
NmrA

Protein Analysis

47

Amino Acids

5.34

Weight (kDa)

9.4

Isoelectric Point (pI)

9.37

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0022280)

Species Orthologous Gene IDs
malus_domestica MD10G1135100.v1.1
pyrus_communis pycom10g11660 pycom10g11990 pycom10g12060

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 133
AjnI CCWGG 2 cut(s) 57, 84
ApeKI GCWGC 1 cut(s) 130
BbvI GCAGC 1 cut(s) 117
BciT130I CCWGG 2 cut(s) 59, 86
BfaI CTAG 1 cut(s) 107
BisI GCNGC 1 cut(s) 131
BlsI GCNGC 1 cut(s) 132
Bme1390I CCNGG 2 cut(s) 59, 86
BmrFI CCNGG 2 cut(s) 59, 86
BmsI GCATC 2 cut(s) 16, 117
BsaAI YACGTR 1 cut(s) 49
BsaJI CCNNGG 2 cut(s) 57, 84
BseBI CCWGG 2 cut(s) 59, 86
BseDI CCNNGG 2 cut(s) 57, 84
BseXI GCAGC 1 cut(s) 117
BspACI CCGC 1 cut(s) 133
BssECI CCNNGG 2 cut(s) 57, 84
Bst2UI CCWGG 2 cut(s) 59, 86
Bst4CI ACNGT 1 cut(s) 79
BstBAI YACGTR 1 cut(s) 49
BstNI CCWGG 2 cut(s) 59, 86
BstSCI CCNGG 2 cut(s) 57, 84
BstV1I GCAGC 1 cut(s) 117
CspCI CAANNNNNGTGG 2 cut(s) 22, 57
CviAII CATG 1 cut(s) 68
EcoRII CCWGG 2 cut(s) 57, 84
EcoT22I ATGCAT 1 cut(s) 73
FaeI CATG 1 cut(s) 71
FaiI YATR 6 cut(s) 6, 16, 46, 69, 102, 104
FatI CATG 1 cut(s) 67
FauI CCCGC 1 cut(s) 126
Fnu4HI GCNGC 1 cut(s) 131
Fsp4HI GCNGC 1 cut(s) 131
FspBI CTAG 1 cut(s) 107
GluI GCNGC 1 cut(s) 131
Hin1II CATG 1 cut(s) 71
Hpy166II GTNNAC 1 cut(s) 52
Hpy8I GTNNAC 1 cut(s) 52
HpyCH4III ACNGT 1 cut(s) 79
HpyCH4IV ACGT 1 cut(s) 48
HpyCH4V TGCA 2 cut(s) 44, 71
HpySE526I ACGT 1 cut(s) 48
Hsp92II CATG 1 cut(s) 71
LpnPI CCDG 4 cut(s) 44, 71, 71, 98
Lsp1109I GCAGC 1 cut(s) 117
LweI GCATC 2 cut(s) 16, 117
MaeI CTAG 1 cut(s) 107
MaeII ACGT 1 cut(s) 48
MluCI AATT 1 cut(s) 39
Mph1103I ATGCAT 1 cut(s) 73
MseI TTAA 1 cut(s) 139
MspR9I CCNGG 2 cut(s) 59, 86
MvaI CCWGG 2 cut(s) 59, 86
NlaIII CATG 1 cut(s) 71
NsiI ATGCAT 1 cut(s) 73
PkrI GCNGC 1 cut(s) 132
Ppu21I YACGTR 1 cut(s) 49
Psp6I CCWGG 2 cut(s) 57, 84
PspGI CCWGG 2 cut(s) 57, 84
SaqAI TTAA 1 cut(s) 139
SatI GCNGC 1 cut(s) 131
ScrFI CCNGG 2 cut(s) 59, 86
SetI ASST 2 cut(s) 51, 63
SfaNI GCATC 2 cut(s) 16, 117
SgeI CNNG 9 cut(s) 48, 61, 70, 71, 80, 97, 98, 119, 134
Sse9I AATT 1 cut(s) 39
SsiI CCGC 1 cut(s) 133
SspMI CTAG 1 cut(s) 107
StyD4I CCNGG 2 cut(s) 57, 84
TaaI ACNGT 1 cut(s) 79
TaiI ACGT 1 cut(s) 51
TasI AATT 1 cut(s) 39
Tru1I TTAA 1 cut(s) 139
Tru9I TTAA 1 cut(s) 139
TseI GCWGC 1 cut(s) 130
TspDTI ATGAA 1 cut(s) 53
XspI CTAG 1 cut(s) 107
Zsp2I ATGCAT 1 cut(s) 73
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.