pycom10g11990

NmrA-like family

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr10
Physical Location & Seq
Forward (+)
15586240 .. 15586536
297 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom10g11990.2

Sequence Viewer

Length: 222 bp
ATGCTAGTTATCCTTCTGTCATTACAGTTTCTTGTGTTTCGTTGGGATTATTGGACAGTATGCAGTATTGCAGTGCCTATATTAGAAGAGAAATCAGTATGGGGAACAGATGGCCCCACAAGAATTGCATACATGGACACCCAGTTTAATCATGCATTGACCGTTTCCCTGGTTGATTTTAGAAATACCTTCTTTTTGTTTACCTCTCGTTATGGTATCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

74

Amino Acids

8.55

Weight (kDa)

5.53

Isoelectric Point (pI)

27.76

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0022280)

Species Orthologous Gene IDs
malus_domestica MD10G1135100.v1.1
pyrus_communis pycom10g11660 pycom10g11990 pycom10g12060

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AjnI CCWGG 1 cut(s) 168
AoxI GGCC 1 cut(s) 112
AspS9I GGNCC 1 cut(s) 113
BccI CCATC 1 cut(s) 104
BciT130I CCWGG 1 cut(s) 170
BfaI CTAG 1 cut(s) 5
Bme1390I CCNGG 1 cut(s) 170
BmgT120I GGNCC 1 cut(s) 113
BmiI GGNNCC 1 cut(s) 115
BmrFI CCNGG 1 cut(s) 170
BmrI ACTGGG 1 cut(s) 136
BmuI ACTGGG 1 cut(s) 136
BsaJI CCNNGG 1 cut(s) 168
Bse1I ACTGG 1 cut(s) 142
BseBI CCWGG 1 cut(s) 170
BseDI CCNNGG 1 cut(s) 168
BseNI ACTGG 1 cut(s) 142
BshFI GGCC 1 cut(s) 114
BsnI GGCC 1 cut(s) 114
BspANI GGCC 1 cut(s) 114
BspLI GGNNCC 1 cut(s) 115
BsrI ACTGG 1 cut(s) 142
BssECI CCNNGG 1 cut(s) 168
Bst2UI CCWGG 1 cut(s) 170
Bst4CI ACNGT 3 cut(s) 27, 58, 163
Bst6I CTCTTC 1 cut(s) 81
BstNI CCWGG 1 cut(s) 170
BstSCI CCNGG 1 cut(s) 168
BsuRI GGCC 1 cut(s) 114
BtsI GCAGTG 1 cut(s) 78
BtsIMutI CAGTG 1 cut(s) 78
Cfr13I GGNCC 1 cut(s) 113
CspCI CAANNNNNGTGG 2 cut(s) 106, 141
CviAII CATG 2 cut(s) 133, 152
CviJI RGCY 1 cut(s) 114
CviKI_1 RGCY 1 cut(s) 114
Eam1104I CTCTTC 1 cut(s) 81
EarI CTCTTC 1 cut(s) 81
EcoRII CCWGG 1 cut(s) 168
EcoT22I ATGCAT 1 cut(s) 157
FaeI CATG 2 cut(s) 136, 155
FaiI YATR 7 cut(s) 61, 80, 100, 130, 134, 153, 213
FatI CATG 2 cut(s) 132, 151
FspBI CTAG 1 cut(s) 5
HaeIII GGCC 1 cut(s) 114
Hin1II CATG 2 cut(s) 136, 155
Hpy166II GTNNAC 1 cut(s) 201
Hpy188I TCNGA 1 cut(s) 221
Hpy8I GTNNAC 1 cut(s) 201
HpyAV CCTTC 2 cut(s) 23, 199
HpyCH4III ACNGT 3 cut(s) 27, 58, 163
HpyCH4V TGCA 4 cut(s) 63, 71, 128, 155
Hsp92II CATG 2 cut(s) 136, 155
LpnPI CCDG 3 cut(s) 155, 155, 182
MaeI CTAG 1 cut(s) 5
MboII GAAGA 1 cut(s) 98
MluCI AATT 1 cut(s) 123
MnlI CCTC 1 cut(s) 214
Mph1103I ATGCAT 1 cut(s) 157
MseI TTAA 1 cut(s) 147
MspR9I CCNGG 1 cut(s) 170
MvaI CCWGG 1 cut(s) 170
NlaIII CATG 2 cut(s) 136, 155
NlaIV GGNNCC 1 cut(s) 115
NsiI ATGCAT 1 cut(s) 157
Psp6I CCWGG 1 cut(s) 168
PspGI CCWGG 1 cut(s) 168
PspN4I GGNNCC 1 cut(s) 115
PspPI GGNCC 1 cut(s) 113
SaqAI TTAA 1 cut(s) 147
Sau96I GGNCC 1 cut(s) 113
ScrFI CCNGG 1 cut(s) 170
SetI ASST 2 cut(s) 191, 206
SgeI CNNG 8 cut(s) 17, 44, 132, 145, 154, 164, 181, 182
Sse9I AATT 1 cut(s) 123
SspMI CTAG 1 cut(s) 5
StyD4I CCNGG 1 cut(s) 168
TaaI ACNGT 3 cut(s) 27, 58, 163
TasI AATT 1 cut(s) 123
Tru1I TTAA 1 cut(s) 147
Tru9I TTAA 1 cut(s) 147
TscAI CASTG 1 cut(s) 78
TspRI CASTG 1 cut(s) 78
XspI CTAG 1 cut(s) 5
Zsp2I ATGCAT 1 cut(s) 157
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.