Basic Information

Type: gene

Biological Identity

Species

malus_domestica

Chromosome

Chr12

Orthogroup ID

OG0024312

Physical Location & Seq

Genomic Coordinates Forward (+)

15592538 .. 15606473

Gene Structure 13936 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

MD12G1100300.v1.1.491

Sequence Viewer

CDS Protein Promoter (2k)

Length: 132 bp

ATGCCAGAAAGTCTGCACTCACCACTCATTAATTATATGGTGAAAGTTTTTACGCAACCTCATTGCTTGCAAAATTTTGTTCAGTCAACATTCAATGCCCTGCCATCAGATCAAGTTAAAGGTATATCTTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000271 GO:0003674 GO:0003824 GO:0004614 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005737 GO:0005829 GO:0005886 GO:0005975 GO:0005976 GO:0005977 GO:0005978 GO:0005982 GO:0005996 GO:0006006 GO:0006012 GO:0006073 GO:0006091 GO:0006112 GO:0008150 GO:0008152 GO:0009056 GO:0009058 GO:0009059 GO:0009250 GO:0009507 GO:0009526 GO:0009532 GO:0009536 GO:0009570 GO:0009581 GO:0009582 GO:0009590 GO:0009605 GO:0009628 GO:0009629 GO:0009987 GO:0010035 GO:0010038 GO:0010319 GO:0015980 GO:0016020 GO:0016051 GO:0016052 GO:0016853 GO:0016866 GO:0016868 GO:0019252 GO:0019318 GO:0019320 GO:0019388 GO:0031967 GO:0031975 GO:0033692 GO:0034637 GO:0034645 GO:0042221 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044042 GO:0044237 GO:0044238 GO:0044249 GO:0044260 GO:0044262 GO:0044264 GO:0044281 GO:0044282 GO:0044422 GO:0044424 GO:0044434 GO:0044435 GO:0044444 GO:0044446 GO:0044464 GO:0046365 GO:0046686 GO:0050896 GO:0051606 GO:0055114 GO:0071704 GO:0071944 GO:1901575 GO:1901576

KEGG Pathways

Metabolic & Signaling

ko00010 ko00030 ko00052 ko00230 ko00500 ko00520 ko00521 ko01100 ko01110 ko01120 ko01130 map00010 map00030 map00052 map00230 map00500 map00520 map00521 map01100 map01110 map01120 map01130

Pfam Domains

Protein Families

PGM_PMM_I PGM_PMM_II PGM_PMM_III PGM_PMM_IV

Protein Analysis

44

Amino Acids

4.85

Weight (kDa)

6.69

Isoelectric Point (pI)

73.27

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0024312)

Species	Orthologous Gene IDs
malus_domestica	MD09G1257200.v1.1 MD12G1100300.v1.1
pyrus_communis	pycom14g14060

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcsI	RAATTY	1 cut(s)	73
AgsI	TTSAA	1 cut(s)	94
ApoI	RAATTY	1 cut(s)	73
AseI	ATTAAT	1 cut(s)	30
AsuHPI	GGTGA	2 cut(s)	12, 52
BccI	CCATC	1 cut(s)	112
Bse3DI	GCAATG	1 cut(s)	61
BseMI	GCAATG	1 cut(s)	61
Bsp143I	GATC	1 cut(s)	109
BsrDI	GCAATG	1 cut(s)	61
BssMI	GATC	1 cut(s)	109
BstC8I	GCNNGC	1 cut(s)	68
BstKTI	GATC	1 cut(s)	112
BstMBI	GATC	1 cut(s)	109
Cac8I	GCNNGC	1 cut(s)	68
DpnI	GATC	1 cut(s)	111
DpnII	GATC	1 cut(s)	109
FaiI	YATR	3 cut(s)	36, 38, 125
FspEI	CC	8 cut(s)	18, 23, 36, 72, 105, 112, 113, 117
HincII	GTYRAC	1 cut(s)	87
HindII	GTYRAC	1 cut(s)	87
HphI	GGTGA	2 cut(s)	12, 52
Hpy166II	GTNNAC	1 cut(s)	87
Hpy188I	TCNGA	1 cut(s)	109
Hpy8I	GTNNAC	1 cut(s)	87
HpyCH4V	TGCA	2 cut(s)	16, 70
Kzo9I	GATC	1 cut(s)	109
LpnPI	CCDG	2 cut(s)	18, 113
MalI	GATC	1 cut(s)	111
MboI	GATC	1 cut(s)	109
MluCI	AATT	2 cut(s)	31, 73
MnlI	CCTC	1 cut(s)	69
MseI	TTAA	3 cut(s)	30, 117, 130
NdeII	GATC	1 cut(s)	109
PshBI	ATTAAT	1 cut(s)	30
SaqAI	TTAA	3 cut(s)	30, 117, 130
Sau3AI	GATC	1 cut(s)	109
SetI	ASST	2 cut(s)	61, 124
SgeI	CNNG	4 cut(s)	17, 79, 112, 125
Sse9I	AATT	2 cut(s)	31, 73
TasI	AATT	2 cut(s)	31, 73
Tru1I	TTAA	3 cut(s)	30, 117, 130
Tru9I	TTAA	3 cut(s)	30, 117, 130
VspI	ATTAAT	1 cut(s)	30
XapI	RAATTY	1 cut(s)	73

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.