pycom14g14060

Belongs to the phosphohexose mutase family

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr14
Physical Location & Seq
Forward (+)
16822353 .. 16823225
873 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom14g14060.3

Sequence Viewer

Length: 186 bp
ATGGTGGGTTTAACTTTTCCGGTGAAAGTTTTTACTCAACCTCATTACTTGCAAAATTTTGTTCAGTCAACATTCAATGCCCTGCCATCAGATCAAGTTAAAGGTGGCTGGCCTGTAGGACATATATTTTACCATCTTAACTTCAAGGGCAATATATGTGTTAACTGTGTTTTATCATGTAGTTAA

Protein Analysis

62

Amino Acids

6.83

Weight (kDa)

8.59

Isoelectric Point (pI)

61.64

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0024312)

Species Orthologous Gene IDs
malus_domestica MD09G1257200.v1.1 MD12G1100300.v1.1
pyrus_communis pycom14g14060

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 55
AgsI TTSAA 2 cut(s) 76, 145
AoxI GGCC 1 cut(s) 110
ApoI RAATTY 1 cut(s) 55
AsuHPI GGTGA 1 cut(s) 34
BccI CCATC 2 cut(s) 94, 141
BfmI CTRYAG 1 cut(s) 114
BsaWI WCCGGW 1 cut(s) 19
BshFI GGCC 1 cut(s) 112
BsiSI CCGG 1 cut(s) 20
BsnI GGCC 1 cut(s) 112
Bsp143I GATC 1 cut(s) 91
BspANI GGCC 1 cut(s) 112
BssMI GATC 1 cut(s) 91
Bst4CI ACNGT 1 cut(s) 167
BstC8I GCNNGC 1 cut(s) 110
BstKTI GATC 1 cut(s) 94
BstMBI GATC 1 cut(s) 91
BstSFI CTRYAG 1 cut(s) 114
BsuRI GGCC 1 cut(s) 112
Cac8I GCNNGC 1 cut(s) 110
CviAII CATG 1 cut(s) 177
CviJI RGCY 2 cut(s) 108, 112
CviKI_1 RGCY 2 cut(s) 108, 112
DpnI GATC 1 cut(s) 93
DpnII GATC 1 cut(s) 91
FaeI CATG 1 cut(s) 180
FaiI YATR 5 cut(s) 123, 125, 155, 157, 178
FatI CATG 1 cut(s) 176
HaeIII GGCC 1 cut(s) 112
HapII CCGG 1 cut(s) 20
Hin1II CATG 1 cut(s) 180
HincII GTYRAC 2 cut(s) 69, 163
HindII GTYRAC 2 cut(s) 69, 163
HpaI GTTAAC 1 cut(s) 163
HpaII CCGG 1 cut(s) 20
HphI GGTGA 1 cut(s) 34
Hpy166II GTNNAC 2 cut(s) 69, 163
Hpy188I TCNGA 1 cut(s) 91
Hpy8I GTNNAC 2 cut(s) 69, 163
HpyCH4III ACNGT 1 cut(s) 167
HpyCH4V TGCA 1 cut(s) 52
Hsp92II CATG 1 cut(s) 180
KspAI GTTAAC 1 cut(s) 163
Kzo9I GATC 1 cut(s) 91
LpnPI CCDG 4 cut(s) 33, 94, 95, 126
MalI GATC 1 cut(s) 93
MboI GATC 1 cut(s) 91
MluCI AATT 1 cut(s) 55
MnlI CCTC 1 cut(s) 51
MseI TTAA 5 cut(s) 11, 99, 138, 162, 184
MspI CCGG 1 cut(s) 20
NdeII GATC 1 cut(s) 91
NlaIII CATG 1 cut(s) 180
SaqAI TTAA 5 cut(s) 11, 99, 138, 162, 184
Sau3AI GATC 1 cut(s) 91
SetI ASST 2 cut(s) 43, 106
SfcI CTRYAG 1 cut(s) 114
SgeI CNNG 7 cut(s) 32, 61, 94, 107, 121, 125, 157
Sse9I AATT 1 cut(s) 55
TaaI ACNGT 1 cut(s) 167
TasI AATT 1 cut(s) 55
Tru1I TTAA 5 cut(s) 11, 99, 138, 162, 184
Tru9I TTAA 5 cut(s) 11, 99, 138, 162, 184
XapI RAATTY 1 cut(s) 55
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.