MD13G1057600.v1.1

Belongs to the cytochrome P450 family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr13
OG0024239
Physical Location & Seq
Reverse (-)
4024005 .. 4024223
219 bp
Loading structure...
UTR
Exon/CDS
Intron
MD13G1057600.v1.1.491

Sequence Viewer

Length: 219 bp
ATGACTATGATCGTGAACGAGTCTCTGAGGTTATATCCTCCTGTTCTTTCCCTTGTCAATAGGAAAGTTGAAAAGGAAACTAGGCTGGGAAGGCTTGTTCTTCCTGCTAACCTCCACTTGGTGATCCCAATTTCACCACTTCATTTTGATCCTCAGTTGTGGGGACAGGACGTGCAACTTTTTGTTGAATTGTGGCCAAGTGGCCATCACCTTTCCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00905 map00905
Pfam Domains
Protein Families
p450

Protein Analysis

73

Amino Acids

8.29

Weight (kDa)

6.9

Isoelectric Point (pI)

44.01

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
p450 PF00067 2 - 54 9.6e-10 Cytochrome P450
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0024239)

Species Orthologous Gene IDs
malus_domestica MD13G1057600.v1.1
rosa_chinensis RchiOBHm_Chr6g0272611
rosa_multiflora Rmu_sc0003080.1_g000002

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 118, 143
AcoI YGGCCR 2 cut(s) 194, 202
AdeI CACNNNGTG 1 cut(s) 121
AfiI CCNNNNNNNGG 1 cut(s) 118
AgsI TTSAA 2 cut(s) 71, 188
AjiI CACGTC 1 cut(s) 172
AloI GAACNNNNNNTCC 2 cut(s) 81, 113
Alw26I GTCTC 1 cut(s) 27
AlwI GGATC 2 cut(s) 118, 143
AoxI GGCC 2 cut(s) 194, 202
AsuHPI GGTGA 3 cut(s) 126, 133, 200
BalI TGGCCA 2 cut(s) 196, 204
BccI CCATC 1 cut(s) 213
BcoDI GTCTC 1 cut(s) 27
BfaI CTAG 1 cut(s) 81
BmgBI CACGTC 1 cut(s) 172
Bsc4I CCNNNNNNNGG 1 cut(s) 118
BseLI CCNNNNNNNGG 1 cut(s) 118
BseMII CTCAG 2 cut(s) 17, 167
BseYI CCCAGC 1 cut(s) 85
BshFI GGCC 2 cut(s) 196, 204
BslFI GGGAC 1 cut(s) 177
BslI CCNNNNNNNGG 1 cut(s) 118
BsmAI GTCTC 1 cut(s) 27
BsmFI GGGAC 1 cut(s) 177
BsnI GGCC 2 cut(s) 196, 204
Bsp143I GATC 3 cut(s) 9, 123, 148
BspANI GGCC 2 cut(s) 196, 204
BspCNI CTCAG 2 cut(s) 18, 166
BspPI GGATC 2 cut(s) 118, 143
BssMI GATC 3 cut(s) 9, 123, 148
BstDEI CTNAG 2 cut(s) 26, 153
BstKTI GATC 3 cut(s) 12, 126, 151
BstMAI GTCTC 1 cut(s) 27
BstMBI GATC 3 cut(s) 9, 123, 148
BstMWI GCNNNNNNNGC 1 cut(s) 91
BsuRI GGCC 2 cut(s) 196, 204
BtrI CACGTC 1 cut(s) 172
CviJI RGCY 4 cut(s) 85, 94, 196, 204
CviKI_1 RGCY 4 cut(s) 85, 94, 196, 204
DdeI CTNAG 2 cut(s) 26, 153
DpnI GATC 3 cut(s) 11, 125, 150
DpnII GATC 3 cut(s) 9, 123, 148
DraIII CACNNNGTG 1 cut(s) 121
EaeI YGGCCR 2 cut(s) 194, 202
FaiI YATR 2 cut(s) 8, 34
FaqI GGGAC 1 cut(s) 177
FspBI CTAG 1 cut(s) 81
GsaI CCCAGC 1 cut(s) 89
HaeIII GGCC 2 cut(s) 196, 204
HinfI GANTC 1 cut(s) 20
HphI GGTGA 3 cut(s) 126, 133, 200
Hpy166II GTNNAC 1 cut(s) 16
Hpy188I TCNGA 1 cut(s) 27
Hpy188III TCNNGA 1 cut(s) 13
Hpy8I GTNNAC 1 cut(s) 16
HpyAV CCTTC 1 cut(s) 84
HpyCH4IV ACGT 1 cut(s) 171
HpyCH4V TGCA 1 cut(s) 175
HpyF10VI GCNNNNNNNGC 1 cut(s) 91
HpyF3I CTNAG 2 cut(s) 26, 153
HpySE526I ACGT 1 cut(s) 171
Kzo9I GATC 3 cut(s) 9, 123, 148
LpnPI CCDG 4 cut(s) 54, 71, 117, 152
MaeI CTAG 1 cut(s) 81
MaeII ACGT 1 cut(s) 171
MalI GATC 3 cut(s) 11, 125, 150
MboI GATC 3 cut(s) 9, 123, 148
MboII GAAGA 1 cut(s) 92
MlsI TGGCCA 2 cut(s) 196, 204
MluCI AATT 2 cut(s) 129, 188
MluNI TGGCCA 2 cut(s) 196, 204
MlyI GAGTC 1 cut(s) 29
MnlI CCTC 4 cut(s) 21, 48, 122, 162
Mox20I TGGCCA 2 cut(s) 196, 204
MscI TGGCCA 2 cut(s) 196, 204
Msp20I TGGCCA 2 cut(s) 196, 204
MwoI GCNNNNNNNGC 1 cut(s) 91
NdeII GATC 3 cut(s) 9, 123, 148
PleI GAGTC 1 cut(s) 28
PpsI GAGTC 1 cut(s) 28
PspFI CCCAGC 1 cut(s) 85
Sau3AI GATC 3 cut(s) 9, 123, 148
SchI GAGTC 1 cut(s) 29
SetI ASST 4 cut(s) 32, 114, 174, 213
Sse9I AATT 2 cut(s) 129, 188
SspMI CTAG 1 cut(s) 81
TaiI ACGT 1 cut(s) 174
TasI AATT 2 cut(s) 129, 188
TspDTI ATGAA 1 cut(s) 131
XspI CTAG 1 cut(s) 81
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.