MD13G1226500.v1.1

Late embryogenesis abundant protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr13
OG0020846
Physical Location & Seq
Forward (+)
22127923 .. 22129257
1335 bp
Loading structure...
UTR
Exon/CDS
Intron
MD13G1226500.v1.1.491

Sequence Viewer

Length: 270 bp
ATGTCTAGCATGCAGCAACCATTCAACGCAGGCCAATCCCAAGGCCAGGGCCAGGCTAAGGCAGAAGAGTGGATGCAGTCCACACAGGAAACAGCGCATCAAGCTAGGAACGCGACATCTGATGCAGCTCAATCAGCCAAGGAGTCTGCCCAGCATGGAAAGGACCAAAGTGCTGGATTTCTTCAGCAGACTGGAGAGCAAGTGATGAACATGGCACATGGTGCTATGGACAGCGTGAAGAACACACTGGGAATGAATGAAAAGAAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

90

Amino Acids

9.56

Weight (kDa)

5.82

Isoelectric Point (pI)

54.67

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0020846)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G13560 AT4G13560
malus_domestica MD13G1226500.v1.1 MD16G1231600.v1.1
prunus_persica Prupe.1G053900_v2.0.a1

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 113
AcuI CTGAAG 1 cut(s) 167
AdeI CACNNNGTG 1 cut(s) 221
AfiI CCNNNNNNNGG 3 cut(s) 46, 52, 58
AgsI TTSAA 1 cut(s) 25
AjnI CCWGG 2 cut(s) 45, 51
AluBI AGCT 2 cut(s) 104, 128
AluI AGCT 2 cut(s) 104, 128
AoxI GGCC 3 cut(s) 31, 43, 49
ApeKI GCWGC 2 cut(s) 13, 125
AspLEI GCGC 1 cut(s) 97
AspS9I GGNCC 2 cut(s) 49, 163
AvaII GGWCC 1 cut(s) 163
BbvI GCAGC 2 cut(s) 25, 137
BciT130I CCWGG 2 cut(s) 47, 53
BfaI CTAG 2 cut(s) 6, 105
BisI GCNGC 2 cut(s) 14, 126
BlsI GCNGC 2 cut(s) 15, 127
Bme1390I CCNGG 2 cut(s) 47, 53
Bme18I GGWCC 1 cut(s) 163
BmgT120I GGNCC 2 cut(s) 49, 163
BmrFI CCNGG 2 cut(s) 47, 53
BmrI ACTGGG 1 cut(s) 257
BmsI GCATC 3 cut(s) 63, 106, 112
BmuI ACTGGG 1 cut(s) 257
BpmI CTGGAG 1 cut(s) 213
Bpu10I CCTNAGC 1 cut(s) 57
BsaJI CCNNGG 3 cut(s) 40, 46, 138
BsaXI ACNNNNNCTCC 2 cut(s) 186, 216
Bsc4I CCNNNNNNNGG 3 cut(s) 46, 52, 58
Bse1I ACTGG 2 cut(s) 196, 252
BseBI CCWGG 2 cut(s) 47, 53
BseDI CCNNGG 3 cut(s) 40, 46, 138
BseGI GGATG 1 cut(s) 78
BseLI CCNNNNNNNGG 3 cut(s) 46, 52, 58
BseNI ACTGG 2 cut(s) 196, 252
BseXI GCAGC 2 cut(s) 25, 137
BseYI CCCAGC 1 cut(s) 150
Bsh1236I CGCG 1 cut(s) 113
BshFI GGCC 3 cut(s) 33, 45, 51
BslI CCNNNNNNNGG 3 cut(s) 46, 52, 58
BsnI GGCC 3 cut(s) 33, 45, 51
BspANI GGCC 3 cut(s) 33, 45, 51
BspFNI CGCG 1 cut(s) 113
BsrI ACTGG 2 cut(s) 196, 252
BssECI CCNNGG 3 cut(s) 40, 46, 138
BssT1I CCWWGG 2 cut(s) 40, 138
Bst2UI CCWGG 2 cut(s) 47, 53
Bst6I CTCTTC 1 cut(s) 60
BstAPI GCANNNNNTGC 1 cut(s) 221
BstC8I GCNNGC 2 cut(s) 11, 31
BstDEI CTNAG 1 cut(s) 57
BstF5I GGATG 1 cut(s) 78
BstFNI CGCG 1 cut(s) 113
BstHHI GCGC 1 cut(s) 97
BstMWI GCNNNNNNNGC 4 cut(s) 101, 110, 134, 221
BstNI CCWGG 2 cut(s) 47, 53
BstNSI RCATGY 1 cut(s) 13
BstSCI CCNGG 2 cut(s) 45, 51
BstUI CGCG 1 cut(s) 113
BstV1I GCAGC 2 cut(s) 25, 137
BstXI CCANNNNNNTGG 1 cut(s) 173
BsuRI GGCC 3 cut(s) 33, 45, 51
BtsCI GGATG 1 cut(s) 78
BtsIMutI CAGTG 1 cut(s) 245
Cac8I GCNNGC 2 cut(s) 11, 31
CfoI GCGC 1 cut(s) 97
Cfr13I GGNCC 2 cut(s) 49, 163
CviAII CATG 4 cut(s) 10, 155, 211, 218
CviJI RGCY 7 cut(s) 33, 45, 51, 56, 104, 128, 137
CviKI_1 RGCY 7 cut(s) 33, 45, 51, 56, 104, 128, 137
DdeI CTNAG 1 cut(s) 57
DraIII CACNNNGTG 1 cut(s) 221
Eam1104I CTCTTC 1 cut(s) 60
EarI CTCTTC 1 cut(s) 60
Eco130I CCWWGG 2 cut(s) 40, 138
Eco47I GGWCC 1 cut(s) 163
Eco57I CTGAAG 1 cut(s) 167
EcoRII CCWGG 2 cut(s) 45, 51
EcoT14I CCWWGG 2 cut(s) 40, 138
ErhI CCWWGG 2 cut(s) 40, 138
FaeI CATG 4 cut(s) 13, 158, 214, 221
FaiI YATR 5 cut(s) 11, 156, 212, 219, 227
FatI CATG 4 cut(s) 9, 154, 210, 217
Fnu4HI GCNGC 2 cut(s) 14, 126
FokI GGATG 1 cut(s) 85
Fsp4HI GCNGC 2 cut(s) 14, 126
FspBI CTAG 2 cut(s) 6, 105
GlaI GCGC 1 cut(s) 96
GluI GCNGC 2 cut(s) 14, 126
GsaI CCCAGC 1 cut(s) 154
GsuI CTGGAG 1 cut(s) 213
HaeIII GGCC 3 cut(s) 33, 45, 51
HhaI GCGC 1 cut(s) 97
Hin1II CATG 4 cut(s) 13, 158, 214, 221
Hin6I GCGC 1 cut(s) 95
HinP1I GCGC 1 cut(s) 95
HinfI GANTC 1 cut(s) 143
Hpy166II GTNNAC 1 cut(s) 81
Hpy188I TCNGA 1 cut(s) 121
Hpy8I GTNNAC 1 cut(s) 81
HpyCH4V TGCA 3 cut(s) 13, 76, 125
HpyF10VI GCNNNNNNNGC 4 cut(s) 101, 110, 134, 221
HpyF3I CTNAG 1 cut(s) 57
Hsp92II CATG 4 cut(s) 13, 158, 214, 221
HspAI GCGC 1 cut(s) 95
Lsp1109I GCAGC 2 cut(s) 25, 137
LweI GCATC 3 cut(s) 63, 106, 112
MaeI CTAG 2 cut(s) 6, 105
MboII GAAGA 3 cut(s) 77, 173, 250
MlyI GAGTC 1 cut(s) 152
MspR9I CCNGG 2 cut(s) 47, 53
MvaI CCWGG 2 cut(s) 47, 53
MvnI CGCG 1 cut(s) 113
MwoI GCNNNNNNNGC 4 cut(s) 101, 110, 134, 221
NlaIII CATG 4 cut(s) 13, 158, 214, 221
NspI RCATGY 1 cut(s) 13
PaeI GCATGC 1 cut(s) 13
PkrI GCNGC 2 cut(s) 15, 127
PleI GAGTC 1 cut(s) 151
PpsI GAGTC 1 cut(s) 151
Psp6I CCWGG 2 cut(s) 45, 51
PspFI CCCAGC 1 cut(s) 150
PspGI CCWGG 2 cut(s) 45, 51
PspPI GGNCC 2 cut(s) 49, 163
SatI GCNGC 2 cut(s) 14, 126
Sau96I GGNCC 2 cut(s) 49, 163
SchI GAGTC 1 cut(s) 152
ScrFI CCNGG 2 cut(s) 47, 53
SetI ASST 2 cut(s) 106, 130
SfaNI GCATC 3 cut(s) 63, 106, 112
SinI GGWCC 1 cut(s) 163
SphI GCATGC 1 cut(s) 13
SspMI CTAG 2 cut(s) 6, 105
StyD4I CCNGG 2 cut(s) 45, 51
StyI CCWWGG 2 cut(s) 40, 138
TscAI CASTG 1 cut(s) 252
TseI GCWGC 2 cut(s) 13, 125
TspDTI ATGAA 2 cut(s) 221, 269
TspRI CASTG 1 cut(s) 252
VpaK11BI GGWCC 1 cut(s) 163
XceI RCATGY 1 cut(s) 13
XspI CTAG 2 cut(s) 6, 105
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.