MD14G1102900.v1.1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr14
OG0022327
Physical Location & Seq
Reverse (-)
15873487 .. 15875921
2435 bp
Loading structure...
UTR
Exon/CDS
Intron
MD14G1102900.v1.1.491

Sequence Viewer

Length: 282 bp
ATGCCACATGGCACTATTTCAGTAGTGGAGTTTGTTAGTATAGTTAGAGGGTTCTTGAAGTCTAGTTATTGTTCTTGGATTGGTGCTCTTGCTGTAATCTTTTCTGGTGGCACTTTTGAAGATTTTGGGAAGTTCATGCTGAAAATCAGTATCTGGGAAGATTTAGTAAGCTATCAGGAGTGTCAATCTCCTTGGTTGATTTGGTTTCTTGGAGTGTCATTCTCTTTTGTTGATTTGGTTTCTTGGAGTTTAACAGCTATAACTATGTTGACAGCCTGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

94

Amino Acids

10.51

Weight (kDa)

4.7

Isoelectric Point (pI)

28.18

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0022327)

Species Orthologous Gene IDs
malus_domestica MD02G1229300.v1.1 MD14G1102900.v1.1
pyrus_communis pycom03g19490 pycom16g17440

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 2 cut(s) 58, 119
AjnI CCWGG 1 cut(s) 275
AluBI AGCT 2 cut(s) 171, 257
AluI AGCT 2 cut(s) 171, 257
Alw21I GWGCWC 1 cut(s) 88
AlwNI CAGNNNCTG 1 cut(s) 153
Bbv12I GWGCWC 1 cut(s) 88
BciT130I CCWGG 1 cut(s) 277
BfaI CTAG 1 cut(s) 63
Bme1390I CCNGG 1 cut(s) 277
BmrFI CCNGG 1 cut(s) 277
BsaJI CCNNGG 1 cut(s) 191
BseBI CCWGG 1 cut(s) 277
BseDI CCNNGG 1 cut(s) 191
BsiHKAI GWGCWC 1 cut(s) 88
Bsp1286I GDGCHC 1 cut(s) 88
BssECI CCNNGG 1 cut(s) 191
BssT1I CCWWGG 1 cut(s) 191
Bst2UI CCWGG 1 cut(s) 277
BstNI CCWGG 1 cut(s) 277
BstSCI CCNGG 1 cut(s) 275
CaiI CAGNNNCTG 1 cut(s) 153
CviAII CATG 2 cut(s) 8, 136
CviJI RGCY 3 cut(s) 171, 257, 275
CviKI_1 RGCY 3 cut(s) 171, 257, 275
Eco130I CCWWGG 1 cut(s) 191
EcoRII CCWGG 1 cut(s) 275
EcoT14I CCWWGG 1 cut(s) 191
ErhI CCWWGG 1 cut(s) 191
FaeI CATG 2 cut(s) 11, 139
FaiI YATR 5 cut(s) 9, 41, 137, 260, 266
FatI CATG 2 cut(s) 7, 135
FspBI CTAG 1 cut(s) 63
Hin1II CATG 2 cut(s) 11, 139
HincII GTYRAC 1 cut(s) 270
HindII GTYRAC 1 cut(s) 270
Hpy166II GTNNAC 1 cut(s) 270
Hpy188III TCNNGA 2 cut(s) 55, 176
Hpy8I GTNNAC 1 cut(s) 270
Hsp92II CATG 2 cut(s) 11, 139
LpnPI CCDG 4 cut(s) 90, 139, 161, 262
MaeI CTAG 1 cut(s) 63
MboII GAAGA 2 cut(s) 131, 170
MhlI GDGCHC 1 cut(s) 88
MnlI CCTC 1 cut(s) 41
MseI TTAA 1 cut(s) 251
MspR9I CCNGG 1 cut(s) 277
MvaI CCWGG 1 cut(s) 277
NlaIII CATG 2 cut(s) 11, 139
Psp6I CCWGG 1 cut(s) 275
PspGI CCWGG 1 cut(s) 275
PstNI CAGNNNCTG 1 cut(s) 153
SaqAI TTAA 1 cut(s) 251
ScrFI CCNGG 1 cut(s) 277
SduI GDGCHC 1 cut(s) 88
SetI ASST 2 cut(s) 173, 259
SspMI CTAG 1 cut(s) 63
StyD4I CCNGG 1 cut(s) 275
StyI CCWWGG 1 cut(s) 191
Tru1I TTAA 1 cut(s) 251
Tru9I TTAA 1 cut(s) 251
TspDTI ATGAA 1 cut(s) 124
XspI CTAG 1 cut(s) 63
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.