MD16G1114400.v1.1

Ankyrin repeats (3 copies)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr16
OG0024344
Physical Location & Seq
Reverse (-)
8079429 .. 8079605
177 bp
Loading structure...
UTR
Exon/CDS
Intron
MD16G1114400.v1.1.491

Sequence Viewer

Length: 177 bp
ATGCTATTGATTAGTGCCGGGTGCAATATCAACTCTCAGACAGAATCTGGAGAAACTGCACTAATGATCTGTGCTAGATATAAACACCAGGAAGGCATTAAAATCCTGGCTTTAGACGGTGCTGATTTTGGCCTGGTGAATGCTACTGGTCATAGTGCTAGCTTAATTGCAGACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Ank_2 Ank_3 Ank_4

Protein Analysis

59

Amino Acids

6.03

Weight (kDa)

5.01

Isoelectric Point (pI)

19.86

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ank_2 PF12796 2 - 44 1.5e-06 Ankyrin repeats (3 copies)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0024344)

Species Orthologous Gene IDs
malus_domestica MD16G1114400.v1.1 MD16G1115000.v1.1
pyrus_communis pycom234g00030

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AjnI CCWGG 3 cut(s) 87, 105, 132
AluBI AGCT 1 cut(s) 162
AluI AGCT 1 cut(s) 162
AlwNI CAGNNNCTG 1 cut(s) 47
AoxI GGCC 1 cut(s) 130
AsuC2I CCSGG 1 cut(s) 19
AsuHPI GGTGA 1 cut(s) 148
AsuNHI GCTAGC 1 cut(s) 158
BciT130I CCWGG 3 cut(s) 89, 107, 134
BcnI CCSGG 1 cut(s) 19
BfaI CTAG 2 cut(s) 75, 159
Bme1390I CCNGG 4 cut(s) 19, 89, 107, 134
BmrFI CCNGG 4 cut(s) 19, 89, 107, 134
BmtI GCTAGC 1 cut(s) 162
BpmI CTGGAG 1 cut(s) 69
BpuMI CCSGG 1 cut(s) 19
Bse1I ACTGG 1 cut(s) 151
BseBI CCWGG 3 cut(s) 89, 107, 134
BseMII CTCAG 1 cut(s) 50
BseNI ACTGG 1 cut(s) 151
BsgI GTGCAG 1 cut(s) 42
BshFI GGCC 1 cut(s) 132
BsiSI CCGG 1 cut(s) 18
BsmI GAATGC 1 cut(s) 145
BsnI GGCC 1 cut(s) 132
Bsp143I GATC 1 cut(s) 66
BspANI GGCC 1 cut(s) 132
BspCNI CTCAG 1 cut(s) 49
BspOI GCTAGC 1 cut(s) 162
BsrI ACTGG 1 cut(s) 151
BssMI GATC 1 cut(s) 66
Bst2UI CCWGG 3 cut(s) 89, 107, 134
Bst4CI ACNGT 1 cut(s) 119
BstC8I GCNNGC 1 cut(s) 160
BstDEI CTNAG 1 cut(s) 36
BstKTI GATC 1 cut(s) 69
BstMBI GATC 1 cut(s) 66
BstNI CCWGG 3 cut(s) 89, 107, 134
BstSCI CCNGG 4 cut(s) 17, 87, 105, 132
BsuRI GGCC 1 cut(s) 132
Cac8I GCNNGC 1 cut(s) 160
CaiI CAGNNNCTG 1 cut(s) 47
CviJI RGCY 3 cut(s) 110, 132, 162
CviKI_1 RGCY 3 cut(s) 110, 132, 162
DdeI CTNAG 1 cut(s) 36
DpnI GATC 1 cut(s) 68
DpnII GATC 1 cut(s) 66
EcoRII CCWGG 3 cut(s) 87, 105, 132
FaiI YATR 2 cut(s) 81, 153
FspBI CTAG 2 cut(s) 75, 159
GsuI CTGGAG 1 cut(s) 69
HaeIII GGCC 1 cut(s) 132
HapII CCGG 1 cut(s) 18
HinfI GANTC 1 cut(s) 44
HpaII CCGG 1 cut(s) 18
HphI GGTGA 1 cut(s) 148
Hpy188I TCNGA 1 cut(s) 39
Hpy188III TCNNGA 1 cut(s) 48
HpyAV CCTTC 1 cut(s) 86
HpyCH4III ACNGT 1 cut(s) 119
HpyCH4V TGCA 3 cut(s) 24, 59, 170
HpyF3I CTNAG 1 cut(s) 36
Kzo9I GATC 1 cut(s) 66
LpnPI CCDG 9 cut(s) 31, 33, 74, 92, 101, 119, 119, 132, 146
MaeI CTAG 2 cut(s) 75, 159
MalI GATC 1 cut(s) 68
MboI GATC 1 cut(s) 66
MluCI AATT 1 cut(s) 165
MseI TTAA 2 cut(s) 99, 164
MspI CCGG 1 cut(s) 18
MspR9I CCNGG 4 cut(s) 19, 89, 107, 134
Mva1269I GAATGC 1 cut(s) 145
MvaI CCWGG 3 cut(s) 89, 107, 134
NciI CCSGG 1 cut(s) 19
NdeII GATC 1 cut(s) 66
NheI GCTAGC 1 cut(s) 158
PctI GAATGC 1 cut(s) 145
PfeI GAWTC 1 cut(s) 44
Psp6I CCWGG 3 cut(s) 87, 105, 132
PspGI CCWGG 3 cut(s) 87, 105, 132
PstNI CAGNNNCTG 1 cut(s) 47
SaqAI TTAA 2 cut(s) 99, 164
Sau3AI GATC 1 cut(s) 66
ScrFI CCNGG 4 cut(s) 19, 89, 107, 134
SetI ASST 1 cut(s) 164
Sse9I AATT 1 cut(s) 165
SspMI CTAG 2 cut(s) 75, 159
StyD4I CCNGG 4 cut(s) 17, 87, 105, 132
TaaI ACNGT 1 cut(s) 119
TasI AATT 1 cut(s) 165
TfiI GAWTC 1 cut(s) 44
Tru1I TTAA 2 cut(s) 99, 164
Tru9I TTAA 2 cut(s) 99, 164
XspI CTAG 2 cut(s) 75, 159
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.