MD16G1247300.v1.1

gag-polypeptide of LTR copia-type

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr16
OG0020375
Physical Location & Seq
Reverse (-)
27624282 .. 27624856
575 bp
Loading structure...
UTR
Exon/CDS
Intron
MD16G1247300.v1.1.491

Sequence Viewer

Length: 261 bp
ATGGCTGATTCAGGCGAAGGCTCTCGCATAGGGAAAGTTGTATTGCGAGTAAAGAGGTATCAATGTAAGAAAGTGCCCTACTTTGAAGACAAAAGTGTGGCTGAGGCGTACGTCGAACTTATTTTTGATATTGGCGATTTGGTGCTGACGAAATGTTTTGCCAAGTTTGAGTCTTGGAAAAAGGTGCTTGAGGAGTTGAAGAAGTCCATGCTAAGGGAGTTATCGGTTCATTGGGATGTTGACAAAACCAATGTGAAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Retrotran_gag_2

Protein Analysis

87

Amino Acids

10.0

Weight (kDa)

8.89

Isoelectric Point (pI)

20.98

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0020375)

Species Orthologous Gene IDs
malus_domestica MD00G1146600.v1.1 MD16G1247300.v1.1
pyrus_communis pycom06g08150 pycom11g18430 pycom12370g00020 pycom13g17960

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 110
AfiI CCNNNNNNNGG 1 cut(s) 213
AgsI TTSAA 2 cut(s) 86, 199
BaeGI GKGCMC 1 cut(s) 78
BbsI GAAGAC 1 cut(s) 93
BbvCI CCTCAGC 1 cut(s) 102
BpiI GAAGAC 1 cut(s) 93
Bpu10I CCTNAGC 2 cut(s) 102, 212
BpuEI CTTGAG 1 cut(s) 209
Bsc4I CCNNNNNNNGG 1 cut(s) 213
BseGI GGATG 1 cut(s) 241
BseLI CCNNNNNNNGG 1 cut(s) 213
BseMII CTCAG 1 cut(s) 93
BseRI GAGGAG 1 cut(s) 206
BseSI GKGCMC 1 cut(s) 78
BsiWI CGTACG 1 cut(s) 108
BslI CCNNNNNNNGG 1 cut(s) 213
Bsp1286I GDGCHC 1 cut(s) 78
BspCNI CTCAG 1 cut(s) 94
BstDEI CTNAG 2 cut(s) 102, 212
BstF5I GGATG 1 cut(s) 241
BstSLI GKGCMC 1 cut(s) 78
BstV2I GAAGAC 1 cut(s) 93
BtsCI GGATG 1 cut(s) 241
Csp6I GTAC 1 cut(s) 109
CviAII CATG 1 cut(s) 208
CviJI RGCY 3 cut(s) 5, 21, 101
CviKI_1 RGCY 3 cut(s) 5, 21, 101
CviQI GTAC 1 cut(s) 109
DdeI CTNAG 2 cut(s) 102, 212
FaeI CATG 1 cut(s) 211
FaiI YATR 2 cut(s) 29, 209
FatI CATG 1 cut(s) 207
FokI GGATG 1 cut(s) 248
Hin1II CATG 1 cut(s) 211
HincII GTYRAC 1 cut(s) 241
HindII GTYRAC 1 cut(s) 241
HinfI GANTC 2 cut(s) 8, 170
Hpy166II GTNNAC 1 cut(s) 241
Hpy8I GTNNAC 1 cut(s) 241
Hpy99I CGWCG 1 cut(s) 116
HpyAV CCTTC 1 cut(s) 11
HpyCH4IV ACGT 1 cut(s) 111
HpyF3I CTNAG 2 cut(s) 102, 212
HpySE526I ACGT 1 cut(s) 111
Hsp92II CATG 1 cut(s) 211
MaeII ACGT 1 cut(s) 111
MboII GAAGA 2 cut(s) 98, 211
MhlI GDGCHC 1 cut(s) 78
MlyI GAGTC 1 cut(s) 179
MnlI CCTC 3 cut(s) 48, 97, 184
MslI CAYNNNNRTG 1 cut(s) 234
NlaIII CATG 1 cut(s) 211
PfeI GAWTC 1 cut(s) 8
Pfl23II CGTACG 1 cut(s) 108
PleI GAGTC 1 cut(s) 178
PpsI GAGTC 1 cut(s) 178
PspLI CGTACG 1 cut(s) 108
RsaI GTAC 1 cut(s) 110
RsaNI GTAC 1 cut(s) 109
RseI CAYNNNNRTG 1 cut(s) 234
SchI GAGTC 1 cut(s) 179
SduI GDGCHC 1 cut(s) 78
SetI ASST 3 cut(s) 59, 114, 186
SgeI CNNG 7 cut(s) 24, 36, 59, 175, 186, 200, 220
SmiMI CAYNNNNRTG 1 cut(s) 234
SmlI CTYRAG 1 cut(s) 188
SmoI CTYRAG 1 cut(s) 188
TaiI ACGT 1 cut(s) 114
TaqI TCGA 1 cut(s) 114
TfiI GAWTC 1 cut(s) 8
TspDTI ATGAA 1 cut(s) 218
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.