MD17G1002200.v1.1

COBW domain-containing protein

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr17
Physical Location & Seq
Reverse (-)
144801 .. 150587
5787 bp
Loading structure...
UTR
Exon/CDS
Intron
MD17G1002200.v1.1.491

Sequence Viewer

Length: 195 bp
ATGTTCGATCCTCCAGTTTCAGAGCAAAACATTGATCCAGTTCCGAGATCCACAAAAAGCAAAGACCATCATGAGGATCACCACACCCATGATCATGTTCATGATCCTGGTGTTTCTTCTGTCAGCATAGTTTGTGAAGGGAACTTAGATCTTGAAAAGGCTAACATATGGCTTGGTACACTGTTGTTTGAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

65

Amino Acids

7.21

Weight (kDa)

5.09

Isoelectric Point (pI)

52.04

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0021125)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 5 cut(s) 2, 29, 42, 84, 98
AfaI GTAC 1 cut(s) 178
AfiI CCNNNNNNNGG 1 cut(s) 73
AgsI TTSAA 2 cut(s) 155, 191
AjnI CCWGG 1 cut(s) 106
AlwI GGATC 5 cut(s) 2, 29, 42, 84, 98
AsuHPI GGTGA 1 cut(s) 71
BccI CCATC 1 cut(s) 75
BciT130I CCWGG 1 cut(s) 108
BclI TGATCA 1 cut(s) 91
BglII AGATCT 1 cut(s) 148
Bme1390I CCNGG 1 cut(s) 108
BmrFI CCNGG 1 cut(s) 108
Bsc4I CCNNNNNNNGG 1 cut(s) 73
Bse1I ACTGG 2 cut(s) 14, 38
BseBI CCWGG 1 cut(s) 108
BseLI CCNNNNNNNGG 1 cut(s) 73
BseNI ACTGG 2 cut(s) 14, 38
BslI CCNNNNNNNGG 1 cut(s) 73
Bsp143I GATC 7 cut(s) 7, 34, 47, 76, 91, 103, 148
BspHI TCATGA 2 cut(s) 70, 100
BspPI GGATC 5 cut(s) 2, 29, 42, 84, 98
BsrI ACTGG 2 cut(s) 14, 38
BssMI GATC 7 cut(s) 7, 34, 47, 76, 91, 103, 148
Bst2UI CCWGG 1 cut(s) 108
Bst4CI ACNGT 1 cut(s) 183
BstDEI CTNAG 1 cut(s) 145
BstKTI GATC 7 cut(s) 10, 37, 50, 79, 94, 106, 151
BstMBI GATC 7 cut(s) 7, 34, 47, 76, 91, 103, 148
BstNI CCWGG 1 cut(s) 108
BstSCI CCNGG 1 cut(s) 106
BstX2I RGATCY 2 cut(s) 47, 148
BstYI RGATCY 2 cut(s) 47, 148
BtsIMutI CAGTG 1 cut(s) 179
CciI TCATGA 2 cut(s) 70, 100
Csp6I GTAC 1 cut(s) 177
CviAII CATG 4 cut(s) 71, 89, 95, 101
CviJI RGCY 2 cut(s) 161, 172
CviKI_1 RGCY 2 cut(s) 161, 172
CviQI GTAC 1 cut(s) 177
DdeI CTNAG 1 cut(s) 145
DpnI GATC 7 cut(s) 9, 36, 49, 78, 93, 105, 150
DpnII GATC 7 cut(s) 7, 34, 47, 76, 91, 103, 148
EcoRII CCWGG 1 cut(s) 106
FaeI CATG 4 cut(s) 74, 92, 98, 104
FaiI YATR 7 cut(s) 72, 90, 96, 102, 128, 167, 169
FatI CATG 4 cut(s) 70, 88, 94, 100
FauNDI CATATG 1 cut(s) 167
FbaI TGATCA 1 cut(s) 91
Hin1II CATG 4 cut(s) 74, 92, 98, 104
HphI GGTGA 1 cut(s) 71
Hpy166II GTNNAC 1 cut(s) 179
Hpy188I TCNGA 2 cut(s) 22, 45
Hpy188III TCNNGA 3 cut(s) 71, 101, 152
Hpy8I GTNNAC 1 cut(s) 179
HpyAV CCTTC 1 cut(s) 131
HpyCH4III ACNGT 1 cut(s) 183
HpyF3I CTNAG 1 cut(s) 145
Hsp92II CATG 4 cut(s) 74, 92, 98, 104
Ksp22I TGATCA 1 cut(s) 91
Kzo9I GATC 7 cut(s) 7, 34, 47, 76, 91, 103, 148
LpnPI CCDG 4 cut(s) 27, 51, 93, 120
MalI GATC 7 cut(s) 9, 36, 49, 78, 93, 105, 150
MboI GATC 7 cut(s) 7, 34, 47, 76, 91, 103, 148
MboII GAAGA 1 cut(s) 108
MflI RGATCY 2 cut(s) 47, 148
MnlI CCTC 2 cut(s) 21, 67
MslI CAYNNNNRTG 3 cut(s) 87, 93, 99
MspR9I CCNGG 1 cut(s) 108
MvaI CCWGG 1 cut(s) 108
NdeI CATATG 1 cut(s) 167
NdeII GATC 7 cut(s) 7, 34, 47, 76, 91, 103, 148
NlaIII CATG 4 cut(s) 74, 92, 98, 104
PagI TCATGA 2 cut(s) 70, 100
Psp6I CCWGG 1 cut(s) 106
PspGI CCWGG 1 cut(s) 106
PsuI RGATCY 2 cut(s) 47, 148
RsaI GTAC 1 cut(s) 178
RsaNI GTAC 1 cut(s) 177
RseI CAYNNNNRTG 3 cut(s) 87, 93, 99
Sau3AI GATC 7 cut(s) 7, 34, 47, 76, 91, 103, 148
ScrFI CCNGG 1 cut(s) 108
SmiMI CAYNNNNRTG 3 cut(s) 87, 93, 99
StyD4I CCNGG 1 cut(s) 106
TaaI ACNGT 1 cut(s) 183
TaqI TCGA 1 cut(s) 6
TscAI CASTG 1 cut(s) 186
TspDTI ATGAA 1 cut(s) 89
TspRI CASTG 1 cut(s) 186
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.