MD17G1200900.v1.1

ribonuclease T2 activity

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr17
OG0024447
Physical Location & Seq
Forward (+)
24275970 .. 24276626
657 bp
Loading structure...
UTR
Exon/CDS
Intron
MD17G1200900.v1.1.491

Sequence Viewer

Length: 474 bp
ATGTTTGTATGTATTATACCGCCAGATGTAAAAACTGAAAGCCAGTTGGAAATTGTTTGTCGAGGAATGCACTCAATCAAGCCGGTCATCAAAGCTTATGGGCTAAAGAAAGGAAAAAAACATGGCAACTATGGGTCTCCCACAACAAAGAATGAGAAGGGTTACTTTGAAGCAGTGATCAAAATGTACAACACAATCGAGAAACAAAACGTATCTGAAATCATCTCAAAGGCTAAGATTGAACCGGATGGGCGGAAATTGAAAATGCCAGCTAAGATTGAACCGGATGGGCGGAAATTGAAAATGCCATACGCAAAGCATTTTTGTTCAACAACTAAGACTGGAATGACTGAATTGGCTGAGGTCACTCTTTGTATTGATCACAACAGAAAGCAGTTGACAGACTGCCCCCACCCATCCAAACAATCATCCCGATATTTATGCCCCGCCAAATTATCTAGTATTAACGCCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Ribonuclease_T2

Protein Analysis

158

Amino Acids

17.63

Weight (kDa)

9.53

Isoelectric Point (pI)

54.86

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribonuclease_T2 PF00445 39 - 136 7.1e-06 Ribonuclease T2 family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0024447)

Species Orthologous Gene IDs
malus_domestica MD17G1200900.v1.1 MD17G1255600.v1.1
pyrus_communis pycom17g25810

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 4 cut(s) 20, 253, 292, 447
AfaI GTAC 1 cut(s) 188
AgsI TTSAA 6 cut(s) 170, 242, 262, 281, 301, 330
AluBI AGCT 2 cut(s) 95, 272
AluI AGCT 2 cut(s) 95, 272
Alw26I GTCTC 1 cut(s) 141
BbvCI CCTCAGC 1 cut(s) 360
BccI CCATC 3 cut(s) 242, 281, 424
BcgI CGANNNNNNTGC 2 cut(s) 423, 457
BclI TGATCA 2 cut(s) 177, 379
BcoDI GTCTC 1 cut(s) 141
BfaI CTAG 2 cut(s) 459, 472
Bpu10I CCTNAGC 1 cut(s) 360
BsaI GGTCTC 1 cut(s) 141
BsaWI WCCGGW 2 cut(s) 244, 283
Bse118I RCCGGY 1 cut(s) 82
Bse1I ACTGG 2 cut(s) 43, 346
BseGI GGATG 4 cut(s) 253, 292, 416, 428
BseMII CTCAG 1 cut(s) 351
BseNI ACTGG 2 cut(s) 43, 346
BsiSI CCGG 3 cut(s) 83, 245, 284
BsmAI GTCTC 1 cut(s) 141
BsmI GAATGC 1 cut(s) 72
Bso31I GGTCTC 1 cut(s) 141
Bsp1407I TGTACA 1 cut(s) 186
Bsp143I GATC 2 cut(s) 177, 379
BspACI CCGC 4 cut(s) 20, 253, 292, 447
BspCNI CTCAG 1 cut(s) 352
BspTNI GGTCTC 1 cut(s) 141
BsrFI RCCGGY 1 cut(s) 82
BsrGI TGTACA 1 cut(s) 186
BsrI ACTGG 2 cut(s) 43, 346
BssAI RCCGGY 1 cut(s) 82
BssMI GATC 2 cut(s) 177, 379
BstAUI TGTACA 1 cut(s) 186
BstC8I GCNNGC 1 cut(s) 270
BstDEI CTNAG 4 cut(s) 234, 273, 336, 360
BstF5I GGATG 4 cut(s) 253, 292, 416, 428
BstKTI GATC 2 cut(s) 180, 382
BstMAI GTCTC 1 cut(s) 141
BstMBI GATC 2 cut(s) 177, 379
BtsCI GGATG 4 cut(s) 253, 292, 416, 428
BtsI GCAGTG 1 cut(s) 180
BtsIMutI CAGTG 1 cut(s) 180
Cac8I GCNNGC 1 cut(s) 270
Cfr10I RCCGGY 1 cut(s) 82
Csp6I GTAC 1 cut(s) 187
CviAII CATG 1 cut(s) 122
CviJI RGCY 7 cut(s) 42, 82, 95, 103, 233, 272, 359
CviKI_1 RGCY 7 cut(s) 42, 82, 95, 103, 233, 272, 359
CviQI GTAC 1 cut(s) 187
DdeI CTNAG 4 cut(s) 234, 273, 336, 360
DpnI GATC 2 cut(s) 179, 381
DpnII GATC 2 cut(s) 177, 379
EciI GGCGGA 2 cut(s) 268, 307
Eco31I GGTCTC 1 cut(s) 141
FaeI CATG 1 cut(s) 125
FaiI YATR 7 cut(s) 10, 17, 99, 123, 132, 310, 442
FalI AAGNNNNNCTT 2 cut(s) 149, 181
FatI CATG 1 cut(s) 121
FauI CCCGC 1 cut(s) 454
FbaI TGATCA 2 cut(s) 177, 379
FokI GGATG 4 cut(s) 260, 299, 403, 415
FspBI CTAG 2 cut(s) 459, 472
HapII CCGG 3 cut(s) 83, 245, 284
Hin1II CATG 1 cut(s) 125
HincII GTYRAC 1 cut(s) 399
HindII GTYRAC 1 cut(s) 399
HindIII AAGCTT 1 cut(s) 93
HpaII CCGG 3 cut(s) 83, 245, 284
Hpy166II GTNNAC 1 cut(s) 399
Hpy188I TCNGA 1 cut(s) 217
Hpy188III TCNNGA 2 cut(s) 199, 432
Hpy8I GTNNAC 1 cut(s) 399
HpyAV CCTTC 1 cut(s) 151
HpyCH4IV ACGT 1 cut(s) 210
HpyCH4V TGCA 1 cut(s) 70
HpyF3I CTNAG 4 cut(s) 234, 273, 336, 360
HpySE526I ACGT 1 cut(s) 210
Hsp92II CATG 1 cut(s) 125
Ksp22I TGATCA 2 cut(s) 177, 379
Kzo9I GATC 2 cut(s) 177, 379
LpnPI CCDG 7 cut(s) 36, 56, 96, 258, 282, 297, 327
MaeI CTAG 2 cut(s) 459, 472
MaeII ACGT 1 cut(s) 210
MaeIII GTNAC 2 cut(s) 161, 364
MalI GATC 2 cut(s) 179, 381
MboI GATC 2 cut(s) 177, 379
MluCI AATT 5 cut(s) 51, 257, 296, 353, 452
MmeI TCCRAC 1 cut(s) 27
MnlI CCTC 2 cut(s) 56, 355
MseI TTAA 1 cut(s) 465
MspI CCGG 3 cut(s) 83, 245, 284
Mva1269I GAATGC 1 cut(s) 72
NdeII GATC 2 cut(s) 177, 379
NlaIII CATG 1 cut(s) 125
NmuCI GTSAC 1 cut(s) 364
PctI GAATGC 1 cut(s) 72
RsaI GTAC 1 cut(s) 188
RsaNI GTAC 1 cut(s) 187
SaqAI TTAA 1 cut(s) 465
Sau3AI GATC 2 cut(s) 177, 379
SetI ASST 4 cut(s) 97, 213, 274, 366
Sse9I AATT 5 cut(s) 51, 257, 296, 353, 452
SsiI CCGC 4 cut(s) 20, 253, 292, 447
SspMI CTAG 2 cut(s) 459, 472
TaiI ACGT 1 cut(s) 213
TaqI TCGA 2 cut(s) 61, 198
TasI AATT 5 cut(s) 51, 257, 296, 353, 452
TatI WGTACW 1 cut(s) 186
Tru1I TTAA 1 cut(s) 465
Tru9I TTAA 1 cut(s) 465
TscAI CASTG 1 cut(s) 180
TseFI GTSAC 1 cut(s) 364
Tsp45I GTSAC 1 cut(s) 364
TspRI CASTG 1 cut(s) 180
XspI CTAG 2 cut(s) 459, 472
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.