MD17G1211600.v1.1

Belongs to the cation transport ATPase (P-type) (TC 3.A.3) family

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr17
Physical Location & Seq
Reverse (-)
25762183 .. 25763411
1229 bp
Loading structure...
UTR
Exon/CDS
Intron
MD17G1211600.v1.1.491

Sequence Viewer

Length: 333 bp
ATGAGTACTCTACGTGATCCAAAAGCCCATCTGAGACAAGGTGATGGCCTTCTGTTTTCAAGGGTCGAACCAAAGCACAAACAAAAGATTCTGAGGTTGCTTAAAGAGGATGGTGAGGTTGTTGCTATGACTATTGATGGAGTGAATGATGCATCTACTTTGAAACTTGTTGATATTGGAATTGTAATGGGCATTTCTGGAACTAAGGTGCTTCTAGAACTGAATGAGAGTGTTGCTGTGTTTAAACAAGTTTCCACAATTTGTTTTTTAAGCCTTGAGGACAAGGCTAATTTTCAAGGGGGAAATATTGTTATGAACCCAATTTGTAATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

111

Amino Acids

12.02

Weight (kDa)

6.72

Isoelectric Point (pI)

26.95

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0022421)

Species Orthologous Gene IDs
malus_domestica MD17G1211600.v1.1
pyrus_communis pycom12g20060
rosa_multiflora Rmu_sc0034329.1_g000001 Rmu_sc0034875.1_g000001

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 11
AfaI GTAC 1 cut(s) 7
AgsI TTSAA 3 cut(s) 60, 163, 296
Alw26I GTCTC 1 cut(s) 28
AlwI GGATC 1 cut(s) 11
AoxI GGCC 1 cut(s) 46
AsuHPI GGTGA 2 cut(s) 53, 125
BccI CCATC 4 cut(s) 36, 38, 104, 131
BcoDI GTCTC 1 cut(s) 28
BfaI CTAG 1 cut(s) 215
BmcAI AGTACT 1 cut(s) 7
BmsI GCATC 2 cut(s) 139, 161
BpuEI CTTGAG 1 cut(s) 296
BsaAI YACGTR 1 cut(s) 14
BseGI GGATG 1 cut(s) 115
BseMII CTCAG 2 cut(s) 23, 83
BshFI GGCC 1 cut(s) 48
BsmAI GTCTC 1 cut(s) 28
BsnI GGCC 1 cut(s) 48
Bsp143I GATC 1 cut(s) 16
BspANI GGCC 1 cut(s) 48
BspCNI CTCAG 2 cut(s) 24, 84
BspPI GGATC 1 cut(s) 11
BssMI GATC 1 cut(s) 16
BstBAI YACGTR 1 cut(s) 14
BstDEI CTNAG 3 cut(s) 32, 92, 204
BstF5I GGATG 1 cut(s) 115
BstKTI GATC 1 cut(s) 19
BstMAI GTCTC 1 cut(s) 28
BstMBI GATC 1 cut(s) 16
BsuRI GGCC 1 cut(s) 48
BtsCI GGATG 1 cut(s) 115
Csp6I GTAC 1 cut(s) 6
CviJI RGCY 4 cut(s) 26, 48, 273, 287
CviKI_1 RGCY 4 cut(s) 26, 48, 273, 287
CviQI GTAC 1 cut(s) 6
DdeI CTNAG 3 cut(s) 32, 92, 204
DpnI GATC 1 cut(s) 18
DpnII GATC 1 cut(s) 16
DraI TTTAAA 1 cut(s) 244
EcoT22I ATGCAT 1 cut(s) 154
FaiI YATR 2 cut(s) 128, 314
FokI GGATG 1 cut(s) 122
FspBI CTAG 1 cut(s) 215
HaeIII GGCC 1 cut(s) 48
HinfI GANTC 1 cut(s) 88
HphI GGTGA 2 cut(s) 53, 125
Hpy188I TCNGA 2 cut(s) 33, 93
Hpy188III TCNNGA 2 cut(s) 198, 215
HpyAV CCTTC 1 cut(s) 59
HpyCH4IV ACGT 1 cut(s) 13
HpyCH4V TGCA 1 cut(s) 152
HpyF3I CTNAG 3 cut(s) 32, 92, 204
HpySE526I ACGT 1 cut(s) 13
Kzo9I GATC 1 cut(s) 16
LpnPI CCDG 1 cut(s) 183
LweI GCATC 2 cut(s) 139, 161
MaeI CTAG 1 cut(s) 215
MaeII ACGT 1 cut(s) 13
MalI GATC 1 cut(s) 18
MboI GATC 1 cut(s) 16
MluCI AATT 5 cut(s) 180, 258, 289, 321, 328
MnlI CCTC 4 cut(s) 87, 100, 109, 271
Mph1103I ATGCAT 1 cut(s) 154
MseI TTAA 3 cut(s) 102, 243, 269
MssI GTTTAAAC 1 cut(s) 244
NdeII GATC 1 cut(s) 16
NsiI ATGCAT 1 cut(s) 154
PfeI GAWTC 1 cut(s) 88
PmeI GTTTAAAC 1 cut(s) 244
Ppu21I YACGTR 1 cut(s) 14
RsaI GTAC 1 cut(s) 7
RsaNI GTAC 1 cut(s) 6
SaqAI TTAA 3 cut(s) 102, 243, 269
Sau3AI GATC 1 cut(s) 16
ScaI AGTACT 1 cut(s) 7
SetI ASST 5 cut(s) 16, 43, 98, 120, 210
SfaNI GCATC 2 cut(s) 139, 161
SmlI CTYRAG 1 cut(s) 275
SmoI CTYRAG 1 cut(s) 275
Sse9I AATT 5 cut(s) 180, 258, 289, 321, 328
SspI AATATT 1 cut(s) 307
SspMI CTAG 1 cut(s) 215
TaiI ACGT 1 cut(s) 16
TaqI TCGA 1 cut(s) 66
TasI AATT 5 cut(s) 180, 258, 289, 321, 328
TatI WGTACW 1 cut(s) 5
TfiI GAWTC 1 cut(s) 88
Tru1I TTAA 3 cut(s) 102, 243, 269
Tru9I TTAA 3 cut(s) 102, 243, 269
TspDTI ATGAA 1 cut(s) 329
XbaI TCTAGA 1 cut(s) 214
XspI CTAG 1 cut(s) 215
ZrmI AGTACT 1 cut(s) 7
Zsp2I ATGCAT 1 cut(s) 154
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.