Rmu_sc0034329.1_g000001

Belongs to the cation transport ATPase (P-type) (TC 3.A.3) family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0034329.1
Physical Location & Seq
Reverse (-)
1 .. 757
757 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0034329.1_g000001.1.cds

Sequence Viewer

Length: 384 bp
ctgagggatccaccaagagaggaggtttttgatgcaattgaagattgccgtgcagcaggaattcgtgttatggtaattactggagataacaagaacacagcagaagctatatgtcgtgaaataggtgtttttggtactcatgaagacataagtacaagaagcataacaggaagagagtttatgaatctacctgatcagaaagcctttctgagacaaggtggtgggctgctcttttcaagggctgaaccaaggcacaaacaagagattgtgaggttgctgaaagatgaaggtgaggtggttgccatgactggtgatggagtaaatgatgcacctgcgttgaaacttgctgatattggaattgcaatgggcattgctggaaccgag

Protein Analysis

128

Amino Acids

13.89

Weight (kDa)

4.98

Isoelectric Point (pI)

39.98

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0022421)

Species Orthologous Gene IDs
malus_domestica MD17G1211600.v1.1
pyrus_communis pycom12g20060
rosa_multiflora Rmu_sc0034329.1_g000001 Rmu_sc0034875.1_g000001

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 340
Acc36I ACCTGC 1 cut(s) 340
AclWI GGATC 2 cut(s) 2, 15
AcsI RAATTY 1 cut(s) 60
AfaI GTAC 2 cut(s) 136, 154
AgsI TTSAA 3 cut(s) 41, 237, 340
AluBI AGCT 1 cut(s) 107
AluI AGCT 1 cut(s) 107
Alw26I GTCTC 1 cut(s) 205
AlwI GGATC 2 cut(s) 2, 15
ApeKI GCWGC 2 cut(s) 53, 226
ApoI RAATTY 1 cut(s) 60
AsuHPI GGTGA 2 cut(s) 302, 323
BamHI GGATCC 1 cut(s) 7
BbsI GAAGAC 1 cut(s) 150
BbvI GCAGC 2 cut(s) 65, 213
BccI CCATC 1 cut(s) 308
BceAI ACGGC 1 cut(s) 33
BclI TGATCA 1 cut(s) 193
BcoDI GTCTC 1 cut(s) 205
BfuAI ACCTGC 1 cut(s) 340
BisI GCNGC 2 cut(s) 54, 227
BlsI GCNGC 2 cut(s) 55, 228
BmiI GGNNCC 2 cut(s) 9, 379
BmsI GCATC 2 cut(s) 22, 316
BpiI GAAGAC 1 cut(s) 150
BpmI CTGGAG 1 cut(s) 102
BsaJI CCNNGG 1 cut(s) 248
Bse1I ACTGG 2 cut(s) 85, 313
Bse3DI GCAATG 2 cut(s) 369, 369
BseDI CCNNGG 1 cut(s) 248
BseMI GCAATG 2 cut(s) 369, 369
BseMII CTCAG 1 cut(s) 200
BseNI ACTGG 2 cut(s) 85, 313
BseRI GAGGAG 1 cut(s) 35
BseXI GCAGC 2 cut(s) 65, 213
BsgI GTGCAG 1 cut(s) 72
BsmAI GTCTC 1 cut(s) 205
Bsp143I GATC 2 cut(s) 7, 193
BspCNI CTCAG 1 cut(s) 201
BspHI TCATGA 1 cut(s) 139
BspLI GGNNCC 2 cut(s) 9, 379
BspMI ACCTGC 1 cut(s) 340
BspPI GGATC 2 cut(s) 2, 15
BsrDI GCAATG 2 cut(s) 369, 369
BsrI ACTGG 2 cut(s) 85, 313
BssECI CCNNGG 1 cut(s) 248
BssMI GATC 2 cut(s) 7, 193
BssT1I CCWWGG 1 cut(s) 248
Bst6I CTCTTC 1 cut(s) 166
BstDEI CTNAG 2 cut(s) 2, 209
BstKTI GATC 2 cut(s) 10, 196
BstMAI GTCTC 1 cut(s) 205
BstMBI GATC 2 cut(s) 7, 193
BstV1I GCAGC 2 cut(s) 65, 213
BstV2I GAAGAC 1 cut(s) 150
BstX2I RGATCY 1 cut(s) 7
BstYI RGATCY 1 cut(s) 7
BveI ACCTGC 1 cut(s) 340
CciI TCATGA 1 cut(s) 139
Csp6I GTAC 2 cut(s) 135, 153
CviAII CATG 2 cut(s) 140, 304
CviJI RGCY 4 cut(s) 107, 203, 226, 242
CviKI_1 RGCY 4 cut(s) 107, 203, 226, 242
CviQI GTAC 2 cut(s) 135, 153
DdeI CTNAG 2 cut(s) 2, 209
DpnI GATC 2 cut(s) 9, 195
DpnII GATC 2 cut(s) 7, 193
Eam1104I CTCTTC 1 cut(s) 166
EarI CTCTTC 1 cut(s) 166
Eco130I CCWWGG 1 cut(s) 248
EcoRI GAATTC 1 cut(s) 60
EcoT14I CCWWGG 1 cut(s) 248
ErhI CCWWGG 1 cut(s) 248
FaeI CATG 2 cut(s) 143, 307
FaiI YATR 8 cut(s) 71, 110, 112, 141, 149, 164, 182, 305
FatI CATG 2 cut(s) 139, 303
FbaI TGATCA 1 cut(s) 193
Fnu4HI GCNGC 2 cut(s) 54, 227
Fsp4HI GCNGC 2 cut(s) 54, 227
GluI GCNGC 2 cut(s) 54, 227
GsuI CTGGAG 1 cut(s) 102
Hin1II CATG 2 cut(s) 143, 307
HinfI GANTC 1 cut(s) 184
HphI GGTGA 2 cut(s) 302, 323
Hpy188I TCNGA 2 cut(s) 198, 210
Hpy188III TCNNGA 2 cut(s) 116, 140
HpyAV CCTTC 1 cut(s) 281
HpyCH4V TGCA 4 cut(s) 35, 53, 329, 362
HpyF3I CTNAG 2 cut(s) 2, 209
Hsp92II CATG 2 cut(s) 143, 307
Ksp22I TGATCA 1 cut(s) 193
Kzo9I GATC 2 cut(s) 7, 193
LpnPI CCDG 7 cut(s) 42, 66, 153, 204, 294, 345, 360
Lsp1109I GCAGC 2 cut(s) 65, 213
LweI GCATC 2 cut(s) 22, 316
MalI GATC 2 cut(s) 9, 195
MboI GATC 2 cut(s) 7, 193
MboII GAAGA 3 cut(s) 53, 155, 183
MfeI CAATTG 1 cut(s) 36
MflI RGATCY 1 cut(s) 7
MluCI AATT 4 cut(s) 36, 60, 75, 357
MnlI CCTC 4 cut(s) 13, 16, 264, 286
MunI CAATTG 1 cut(s) 36
NdeII GATC 2 cut(s) 7, 193
NlaIII CATG 2 cut(s) 143, 307
NlaIV GGNNCC 2 cut(s) 9, 379
PagI TCATGA 1 cut(s) 139
PaqCI CACCTGC 1 cut(s) 340
PfeI GAWTC 1 cut(s) 184
PkrI GCNGC 2 cut(s) 55, 228
PspN4I GGNNCC 2 cut(s) 9, 379
PsuI RGATCY 1 cut(s) 7
RsaI GTAC 2 cut(s) 136, 154
RsaNI GTAC 2 cut(s) 135, 153
SatI GCNGC 2 cut(s) 54, 227
Sau3AI GATC 2 cut(s) 7, 193
SetI ASST 9 cut(s) 27, 109, 127, 193, 220, 275, 292, 297, 334
SfaNI GCATC 2 cut(s) 22, 316
Sse9I AATT 4 cut(s) 36, 60, 75, 357
StyI CCWWGG 1 cut(s) 248
TasI AATT 4 cut(s) 36, 60, 75, 357
TatI WGTACW 1 cut(s) 152
TfiI GAWTC 1 cut(s) 184
TseI GCWGC 2 cut(s) 53, 226
TspDTI ATGAA 3 cut(s) 156, 197, 300
XapI RAATTY 1 cut(s) 60
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.