Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0034875.1

Orthogroup ID

OG0022421

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 760

Gene Structure 760 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0034875.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 384 bp

ctgagggatccaccaagagaggaggtttttgatgcaattgaagattgccgtgcggcaggaattcgtgttatggtaattactggagataacaagaacacagcagaagctatatgtcgtgaaataggtgtttttggtactcatgaagacataagtgcaagaagcataacaggaagagagtttatgaatctgcctgatcagaaagcctttctgagacaaggtggtgggctgctcttttcaagggctgaaccaaggcacaaacaagagattgtgaggttgctgaaagatgaaggtgaggtggttgccatgactggtgatggagtaaatgatgcacctgcattgaaacttgctgatattggaattgcaatgggcattgctggaaccgag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0005215 GO:0005388 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005773 GO:0005774 GO:0005783 GO:0005789 GO:0005886 GO:0006810 GO:0006811 GO:0006812 GO:0006816 GO:0008150 GO:0008324 GO:0010035 GO:0010038 GO:0010042 GO:0012505 GO:0015075 GO:0015085 GO:0015318 GO:0015399 GO:0015405 GO:0015662 GO:0016020 GO:0016021 GO:0016462 GO:0016787 GO:0016817 GO:0016818 GO:0016887 GO:0017111 GO:0019829 GO:0022804 GO:0022853 GO:0022857 GO:0022890 GO:0030001 GO:0030176 GO:0031090 GO:0031224 GO:0031227 GO:0031984 GO:0034220 GO:0042175 GO:0042221 GO:0042623 GO:0042625 GO:0042626 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043492 GO:0044422 GO:0044424 GO:0044425 GO:0044432 GO:0044437 GO:0044444 GO:0044446 GO:0044464 GO:0046686 GO:0046873 GO:0050896 GO:0051179 GO:0051234 GO:0055085 GO:0070588 GO:0070838 GO:0071944 GO:0072511 GO:0090662 GO:0098588 GO:0098655 GO:0098660 GO:0098662 GO:0098805 GO:0098827 GO:0099131 GO:0099132

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Cation_ATPase Cation_ATPase_C Cation_ATPase_N E1-E2_ATPase Hydrolase Hydrolase_3

Protein Analysis

128

Amino Acids

13.86

Weight (kDa)

4.98

Isoelectric Point (pI)

39.98

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0022421)

Species	Orthologous Gene IDs
malus_domestica	MD17G1211600.v1.1
pyrus_communis	pycom12g20060
rosa_multiflora	Rmu_sc0034329.1_g000001 Rmu_sc0034875.1_g000001

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AarI	CACCTGC	1 cut(s)	340
Acc36I	ACCTGC	1 cut(s)	340
AciI	CCGC	1 cut(s)	53
AclWI	GGATC	2 cut(s)	2, 15
AcsI	RAATTY	1 cut(s)	60
AfaI	GTAC	1 cut(s)	136
AgsI	TTSAA	3 cut(s)	41, 237, 340
AluBI	AGCT	1 cut(s)	107
AluI	AGCT	1 cut(s)	107
Alw26I	GTCTC	1 cut(s)	205
AlwI	GGATC	2 cut(s)	2, 15
ApeKI	GCWGC	1 cut(s)	226
ApoI	RAATTY	1 cut(s)	60
AsuHPI	GGTGA	2 cut(s)	302, 323
BamHI	GGATCC	1 cut(s)	7
BbsI	GAAGAC	1 cut(s)	150
BbvI	GCAGC	1 cut(s)	213
BccI	CCATC	1 cut(s)	308
BceAI	ACGGC	1 cut(s)	33
BclI	TGATCA	1 cut(s)	193
BcoDI	GTCTC	1 cut(s)	205
BfuAI	ACCTGC	1 cut(s)	340
BisI	GCNGC	2 cut(s)	54, 227
BlsI	GCNGC	2 cut(s)	55, 228
BmiI	GGNNCC	2 cut(s)	9, 379
BmsI	GCATC	2 cut(s)	22, 316
BpiI	GAAGAC	1 cut(s)	150
BpmI	CTGGAG	1 cut(s)	102
BsaJI	CCNNGG	1 cut(s)	248
Bse1I	ACTGG	2 cut(s)	85, 313
Bse3DI	GCAATG	2 cut(s)	369, 369
BseDI	CCNNGG	1 cut(s)	248
BseMI	GCAATG	2 cut(s)	369, 369
BseMII	CTCAG	1 cut(s)	200
BseNI	ACTGG	2 cut(s)	85, 313
BseRI	GAGGAG	1 cut(s)	35
BseXI	GCAGC	1 cut(s)	213
BsmAI	GTCTC	1 cut(s)	205
Bsp143I	GATC	2 cut(s)	7, 193
BspACI	CCGC	1 cut(s)	53
BspCNI	CTCAG	1 cut(s)	201
BspHI	TCATGA	1 cut(s)	139
BspLI	GGNNCC	2 cut(s)	9, 379
BspMI	ACCTGC	1 cut(s)	340
BspPI	GGATC	2 cut(s)	2, 15
BsrDI	GCAATG	2 cut(s)	369, 369
BsrI	ACTGG	2 cut(s)	85, 313
BssECI	CCNNGG	1 cut(s)	248
BssMI	GATC	2 cut(s)	7, 193
BssT1I	CCWWGG	1 cut(s)	248
Bst6I	CTCTTC	1 cut(s)	166
BstDEI	CTNAG	2 cut(s)	2, 209
BstKTI	GATC	2 cut(s)	10, 196
BstMAI	GTCTC	1 cut(s)	205
BstMBI	GATC	2 cut(s)	7, 193
BstV1I	GCAGC	1 cut(s)	213
BstV2I	GAAGAC	1 cut(s)	150
BstX2I	RGATCY	1 cut(s)	7
BstYI	RGATCY	1 cut(s)	7
BveI	ACCTGC	1 cut(s)	340
CciI	TCATGA	1 cut(s)	139
Csp6I	GTAC	1 cut(s)	135
CviAII	CATG	2 cut(s)	140, 304
CviJI	RGCY	4 cut(s)	107, 203, 226, 242
CviKI_1	RGCY	4 cut(s)	107, 203, 226, 242
CviQI	GTAC	1 cut(s)	135
DdeI	CTNAG	2 cut(s)	2, 209
DpnI	GATC	2 cut(s)	9, 195
DpnII	GATC	2 cut(s)	7, 193
Eam1104I	CTCTTC	1 cut(s)	166
EarI	CTCTTC	1 cut(s)	166
Eco130I	CCWWGG	1 cut(s)	248
EcoRI	GAATTC	1 cut(s)	60
EcoT14I	CCWWGG	1 cut(s)	248
ErhI	CCWWGG	1 cut(s)	248
FaeI	CATG	2 cut(s)	143, 307
FaiI	YATR	8 cut(s)	71, 110, 112, 141, 149, 164, 182, 305
FatI	CATG	2 cut(s)	139, 303
FbaI	TGATCA	1 cut(s)	193
Fnu4HI	GCNGC	2 cut(s)	54, 227
Fsp4HI	GCNGC	2 cut(s)	54, 227
GluI	GCNGC	2 cut(s)	54, 227
GsuI	CTGGAG	1 cut(s)	102
Hin1II	CATG	2 cut(s)	143, 307
HinfI	GANTC	1 cut(s)	184
HphI	GGTGA	2 cut(s)	302, 323
Hpy188I	TCNGA	2 cut(s)	198, 210
Hpy188III	TCNNGA	2 cut(s)	116, 140
HpyAV	CCTTC	1 cut(s)	281
HpyCH4V	TGCA	5 cut(s)	35, 155, 329, 335, 362
HpyF3I	CTNAG	2 cut(s)	2, 209
Hsp92II	CATG	2 cut(s)	143, 307
Ksp22I	TGATCA	1 cut(s)	193
Kzo9I	GATC	2 cut(s)	7, 193
LpnPI	CCDG	7 cut(s)	42, 66, 153, 204, 294, 345, 360
Lsp1109I	GCAGC	1 cut(s)	213
LweI	GCATC	2 cut(s)	22, 316
MalI	GATC	2 cut(s)	9, 195
MboI	GATC	2 cut(s)	7, 193
MboII	GAAGA	3 cut(s)	53, 155, 183
MfeI	CAATTG	1 cut(s)	36
MflI	RGATCY	1 cut(s)	7
MluCI	AATT	4 cut(s)	36, 60, 75, 357
MnlI	CCTC	4 cut(s)	13, 16, 264, 286
MunI	CAATTG	1 cut(s)	36
NdeII	GATC	2 cut(s)	7, 193
NlaIII	CATG	2 cut(s)	143, 307
NlaIV	GGNNCC	2 cut(s)	9, 379
PagI	TCATGA	1 cut(s)	139
PaqCI	CACCTGC	1 cut(s)	340
PfeI	GAWTC	1 cut(s)	184
PkrI	GCNGC	2 cut(s)	55, 228
PspN4I	GGNNCC	2 cut(s)	9, 379
PsuI	RGATCY	1 cut(s)	7
RsaI	GTAC	1 cut(s)	136
RsaNI	GTAC	1 cut(s)	135
SatI	GCNGC	2 cut(s)	54, 227
Sau3AI	GATC	2 cut(s)	7, 193
SetI	ASST	8 cut(s)	27, 109, 127, 220, 275, 292, 297, 334
SfaNI	GCATC	2 cut(s)	22, 316
Sse9I	AATT	4 cut(s)	36, 60, 75, 357
SsiI	CCGC	1 cut(s)	53
StyI	CCWWGG	1 cut(s)	248
TasI	AATT	4 cut(s)	36, 60, 75, 357
TauI	GCSGC	1 cut(s)	56
TfiI	GAWTC	1 cut(s)	184
TseI	GCWGC	1 cut(s)	226
TspDTI	ATGAA	3 cut(s)	156, 197, 300
XapI	RAATTY	1 cut(s)	60

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.