Prupe.1G053900_v2.0.a1

Late embryogenesis abundant protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp01
OG0020846
Physical Location & Seq
Forward (+)
3748512 .. 3749601
1090 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.1G053900.1_v2.0.a1.CDS.2

Sequence Viewer

Length: 270 bp
ATGTCTAGCATGCAGCAACCCTTGAATGCAGGCCAAGCCCAAGGCCAGGGCCAGGCTAAGGCAGAAGAGTGGATGCAATCCACACAGGACACAGCAAATCAAGCTAGGAACGTGACATCTGATGCAGCTCAATCAGCCAAGGAGTCTGCCCAGCATGGAAAGGACCAAAGTGCTGGATTTATTCAGCAGACTGGAGAGCAAGTGATGAACATGGCTCATGGTGCCATGGACAGTGTGAAGAGCACACTTGGCATGAATGAAAAGAAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

90

Amino Acids

9.47

Weight (kDa)

5.51

Isoelectric Point (pI)

40.16

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0020846)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G13560 AT4G13560
malus_domestica MD13G1226500.v1.1 MD16G1231600.v1.1
prunus_persica Prupe.1G053900_v2.0.a1

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 221
AfiI CCNNNNNNNGG 3 cut(s) 46, 52, 58
AgsI TTSAA 1 cut(s) 25
AjnI CCWGG 2 cut(s) 45, 51
AluBI AGCT 2 cut(s) 104, 128
AluI AGCT 2 cut(s) 104, 128
Alw21I GWGCWC 1 cut(s) 245
AoxI GGCC 3 cut(s) 31, 43, 49
ApeKI GCWGC 2 cut(s) 13, 125
AspS9I GGNCC 2 cut(s) 49, 163
AvaII GGWCC 1 cut(s) 163
BanI GGYRCC 1 cut(s) 221
Bbv12I GWGCWC 1 cut(s) 245
BbvI GCAGC 2 cut(s) 25, 137
BciT130I CCWGG 2 cut(s) 47, 53
BfaI CTAG 2 cut(s) 6, 105
BisI GCNGC 2 cut(s) 14, 126
BlsI GCNGC 2 cut(s) 15, 127
Bme1390I CCNGG 2 cut(s) 47, 53
Bme18I GGWCC 1 cut(s) 163
BmgT120I GGNCC 2 cut(s) 49, 163
BmiI GGNNCC 1 cut(s) 223
BmrFI CCNGG 2 cut(s) 47, 53
BmsI GCATC 2 cut(s) 63, 112
BpmI CTGGAG 1 cut(s) 213
Bpu10I CCTNAGC 1 cut(s) 57
BsaJI CCNNGG 4 cut(s) 40, 46, 138, 225
BsaXI ACNNNNNCTCC 2 cut(s) 186, 216
Bsc4I CCNNNNNNNGG 3 cut(s) 46, 52, 58
Bse1I ACTGG 1 cut(s) 196
BseBI CCWGG 2 cut(s) 47, 53
BseDI CCNNGG 4 cut(s) 40, 46, 138, 225
BseGI GGATG 1 cut(s) 78
BseLI CCNNNNNNNGG 3 cut(s) 46, 52, 58
BseNI ACTGG 1 cut(s) 196
BseXI GCAGC 2 cut(s) 25, 137
BseYI CCCAGC 1 cut(s) 150
BshFI GGCC 3 cut(s) 33, 45, 51
BshNI GGYRCC 1 cut(s) 221
BsiHKAI GWGCWC 1 cut(s) 245
BslI CCNNNNNNNGG 3 cut(s) 46, 52, 58
BsmI GAATGC 1 cut(s) 31
BsnI GGCC 3 cut(s) 33, 45, 51
Bsp1286I GDGCHC 1 cut(s) 245
Bsp19I CCATGG 1 cut(s) 225
BspANI GGCC 3 cut(s) 33, 45, 51
BspLI GGNNCC 1 cut(s) 223
BspQI GCTCTTC 1 cut(s) 233
BspT107I GGYRCC 1 cut(s) 221
BsrI ACTGG 1 cut(s) 196
BssECI CCNNGG 4 cut(s) 40, 46, 138, 225
BssT1I CCWWGG 3 cut(s) 40, 138, 225
Bst2UI CCWGG 2 cut(s) 47, 53
Bst4CI ACNGT 1 cut(s) 233
Bst6I CTCTTC 2 cut(s) 60, 233
BstC8I GCNNGC 2 cut(s) 11, 31
BstDEI CTNAG 1 cut(s) 57
BstDSI CCRYGG 1 cut(s) 225
BstF5I GGATG 1 cut(s) 78
BstMWI GCNNNNNNNGC 5 cut(s) 35, 101, 134, 221, 249
BstNI CCWGG 2 cut(s) 47, 53
BstNSI RCATGY 1 cut(s) 13
BstSCI CCNGG 2 cut(s) 45, 51
BstV1I GCAGC 2 cut(s) 25, 137
BstXI CCANNNNNNTGG 1 cut(s) 173
BsuRI GGCC 3 cut(s) 33, 45, 51
BtgI CCRYGG 1 cut(s) 225
BtsCI GGATG 1 cut(s) 78
BtsIMutI CAGTG 1 cut(s) 238
Cac8I GCNNGC 2 cut(s) 11, 31
Cfr13I GGNCC 2 cut(s) 49, 163
CviAII CATG 6 cut(s) 10, 155, 211, 218, 226, 253
CviJI RGCY 9 cut(s) 33, 38, 45, 51, 56, 104, 128, 137, 215
CviKI_1 RGCY 9 cut(s) 33, 38, 45, 51, 56, 104, 128, 137, 215
DdeI CTNAG 1 cut(s) 57
Eam1104I CTCTTC 2 cut(s) 60, 233
EarI CTCTTC 2 cut(s) 60, 233
Eco130I CCWWGG 3 cut(s) 40, 138, 225
Eco47I GGWCC 1 cut(s) 163
EcoRII CCWGG 2 cut(s) 45, 51
EcoT14I CCWWGG 3 cut(s) 40, 138, 225
ErhI CCWWGG 3 cut(s) 40, 138, 225
FaeI CATG 6 cut(s) 13, 158, 214, 221, 229, 256
FaiI YATR 6 cut(s) 11, 156, 212, 219, 227, 254
FatI CATG 6 cut(s) 9, 154, 210, 217, 225, 252
Fnu4HI GCNGC 2 cut(s) 14, 126
FokI GGATG 1 cut(s) 85
Fsp4HI GCNGC 2 cut(s) 14, 126
FspBI CTAG 2 cut(s) 6, 105
GluI GCNGC 2 cut(s) 14, 126
GsaI CCCAGC 1 cut(s) 154
GsuI CTGGAG 1 cut(s) 213
HaeIII GGCC 3 cut(s) 33, 45, 51
Hin1II CATG 6 cut(s) 13, 158, 214, 221, 229, 256
HinfI GANTC 1 cut(s) 143
Hpy188I TCNGA 1 cut(s) 121
HpyCH4III ACNGT 1 cut(s) 233
HpyCH4IV ACGT 1 cut(s) 111
HpyCH4V TGCA 4 cut(s) 13, 29, 76, 125
HpyF10VI GCNNNNNNNGC 5 cut(s) 35, 101, 134, 221, 249
HpyF3I CTNAG 1 cut(s) 57
HpySE526I ACGT 1 cut(s) 111
Hsp92II CATG 6 cut(s) 13, 158, 214, 221, 229, 256
LguI GCTCTTC 1 cut(s) 233
LpnPI CCDG 9 cut(s) 15, 32, 38, 59, 65, 71, 159, 164, 177
Lsp1109I GCAGC 2 cut(s) 25, 137
LweI GCATC 2 cut(s) 63, 112
MaeI CTAG 2 cut(s) 6, 105
MaeII ACGT 1 cut(s) 111
MaeIII GTNAC 1 cut(s) 112
MboII GAAGA 2 cut(s) 77, 250
MhlI GDGCHC 1 cut(s) 245
MlyI GAGTC 1 cut(s) 152
MspR9I CCNGG 2 cut(s) 47, 53
Mva1269I GAATGC 1 cut(s) 31
MvaI CCWGG 2 cut(s) 47, 53
MwoI GCNNNNNNNGC 5 cut(s) 35, 101, 134, 221, 249
NcoI CCATGG 1 cut(s) 225
NlaIII CATG 6 cut(s) 13, 158, 214, 221, 229, 256
NlaIV GGNNCC 1 cut(s) 223
NmuCI GTSAC 1 cut(s) 112
NspI RCATGY 1 cut(s) 13
PaeI GCATGC 1 cut(s) 13
PciSI GCTCTTC 1 cut(s) 233
PctI GAATGC 1 cut(s) 31
PkrI GCNGC 2 cut(s) 15, 127
PleI GAGTC 1 cut(s) 151
PpsI GAGTC 1 cut(s) 151
Psp6I CCWGG 2 cut(s) 45, 51
PspFI CCCAGC 1 cut(s) 150
PspGI CCWGG 2 cut(s) 45, 51
PspN4I GGNNCC 1 cut(s) 223
PspPI GGNCC 2 cut(s) 49, 163
SapI GCTCTTC 1 cut(s) 233
SatI GCNGC 2 cut(s) 14, 126
Sau96I GGNCC 2 cut(s) 49, 163
SchI GAGTC 1 cut(s) 152
ScrFI CCNGG 2 cut(s) 47, 53
SduI GDGCHC 1 cut(s) 245
SetI ASST 3 cut(s) 106, 114, 130
SfaNI GCATC 2 cut(s) 63, 112
SinI GGWCC 1 cut(s) 163
SphI GCATGC 1 cut(s) 13
SspMI CTAG 2 cut(s) 6, 105
StyD4I CCNGG 2 cut(s) 45, 51
StyI CCWWGG 3 cut(s) 40, 138, 225
TaaI ACNGT 1 cut(s) 233
TaiI ACGT 1 cut(s) 114
TscAI CASTG 1 cut(s) 238
TseFI GTSAC 1 cut(s) 112
TseI GCWGC 2 cut(s) 13, 125
Tsp45I GTSAC 1 cut(s) 112
TspDTI ATGAA 2 cut(s) 221, 269
TspRI CASTG 1 cut(s) 238
VpaK11BI GGWCC 1 cut(s) 163
XceI RCATGY 1 cut(s) 13
XspI CTAG 2 cut(s) 6, 105
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.