Prupe.2G092400_v2.0.a1

Protein of unknown function (DUF1664)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp02
OG0022448
Physical Location & Seq
Forward (+)
14557417 .. 14559161
1745 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.2G092400.1

Sequence Viewer

Length: 351 bp
ATGCCAACAGCTACCTTGGGGGCATTGGGTTATGGTTACATGTGGTGGAAGGGTCTAAAATTCTCAGATCTTATGTATGTGACAAAGCGTAGTATGAATGCTGCTGTTTCAAAATTGCATAAACGTCTGGAGAGCGTGACAGAGGCTATTGCTAGAGTCCAGAATTTGGACGATAAATTGCTAGAGCAGAAATATATCGAAAAGTCGATTATGGACAATGGTCTAAAAGAAATTGCGGAGTCTCTGTCTGGAACTTTGACTAAGTCAACTGATGCTATTGTGCAAGACGATATTGAAGGTCCAGGAATGAAACCAACAAACCTGCTGAGGTCGGTCTCAACCAAGTGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF1664

Protein Analysis

117

Amino Acids

12.89

Weight (kDa)

8.66

Isoelectric Point (pI)

40.48

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0022448)

Species Orthologous Gene IDs
prunus_persica Prupe.1G476000_v2.0.a1 Prupe.2G092400_v2.0.a1 Prupe.3G110800_v2.0.a1 Prupe.4G273100_v2.0.a1

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 330
AccB7I CCANNNNNTGG 1 cut(s) 166
AciI CCGC 1 cut(s) 236
AcsI RAATTY 2 cut(s) 59, 163
AfiI CCNNNNNNNGG 1 cut(s) 166
AflIII ACRYGT 1 cut(s) 39
AgsI TTSAA 2 cut(s) 111, 296
AjnI CCWGG 1 cut(s) 301
AluBI AGCT 1 cut(s) 11
AluI AGCT 1 cut(s) 11
Alw26I GTCTC 2 cut(s) 246, 340
ApeKI GCWGC 1 cut(s) 101
ApoI RAATTY 2 cut(s) 59, 163
AspS9I GGNCC 1 cut(s) 299
AvaII GGWCC 1 cut(s) 299
BbvCI CCTCAGC 1 cut(s) 326
BbvI GCAGC 1 cut(s) 88
BciT130I CCWGG 1 cut(s) 303
BcoDI GTCTC 2 cut(s) 246, 340
BfaI CTAG 2 cut(s) 153, 182
BfuAI ACCTGC 1 cut(s) 330
BglII AGATCT 1 cut(s) 67
BisI GCNGC 1 cut(s) 102
BlsI GCNGC 1 cut(s) 103
Bme1390I CCNGG 1 cut(s) 303
Bme18I GGWCC 1 cut(s) 299
BmgT120I GGNCC 1 cut(s) 299
BmrFI CCNGG 1 cut(s) 303
BmsI GCATC 1 cut(s) 262
BoxI GACNNNNGTC 1 cut(s) 219
BpmI CTGGAG 1 cut(s) 149
Bpu10I CCTNAGC 1 cut(s) 326
BsaI GGTCTC 1 cut(s) 340
BsaJI CCNNGG 1 cut(s) 15
BsaXI ACNNNNNCTCC 2 cut(s) 230, 260
Bsc4I CCNNNNNNNGG 1 cut(s) 166
BseBI CCWGG 1 cut(s) 303
BseDI CCNNGG 1 cut(s) 15
BseLI CCNNNNNNNGG 1 cut(s) 166
BseMII CTCAG 2 cut(s) 78, 317
BseXI GCAGC 1 cut(s) 88
BslI CCNNNNNNNGG 1 cut(s) 166
BsmAI GTCTC 2 cut(s) 246, 340
BsmI GAATGC 1 cut(s) 103
Bso31I GGTCTC 1 cut(s) 340
Bsp143I GATC 1 cut(s) 67
BspACI CCGC 1 cut(s) 236
BspCNI CTCAG 2 cut(s) 77, 318
BspMI ACCTGC 1 cut(s) 330
BspTNI GGTCTC 1 cut(s) 340
BssECI CCNNGG 1 cut(s) 15
BssMI GATC 1 cut(s) 67
BssT1I CCWWGG 1 cut(s) 15
Bst2UI CCWGG 1 cut(s) 303
BstDEI CTNAG 3 cut(s) 64, 261, 326
BstKTI GATC 1 cut(s) 70
BstMAI GTCTC 2 cut(s) 246, 340
BstMBI GATC 1 cut(s) 67
BstNI CCWGG 1 cut(s) 303
BstNSI RCATGY 1 cut(s) 43
BstPAI GACNNNNGTC 1 cut(s) 219
BstSCI CCNGG 1 cut(s) 301
BstV1I GCAGC 1 cut(s) 88
BstX2I RGATCY 1 cut(s) 67
BstYI RGATCY 1 cut(s) 67
BveI ACCTGC 1 cut(s) 330
Cfr13I GGNCC 1 cut(s) 299
CviAII CATG 1 cut(s) 40
CviJI RGCY 2 cut(s) 11, 146
CviKI_1 RGCY 2 cut(s) 11, 146
DdeI CTNAG 3 cut(s) 64, 261, 326
DpnI GATC 1 cut(s) 69
DpnII GATC 1 cut(s) 67
Eco130I CCWWGG 1 cut(s) 15
Eco31I GGTCTC 1 cut(s) 340
Eco47I GGWCC 1 cut(s) 299
EcoRII CCWGG 1 cut(s) 301
EcoT14I CCWWGG 1 cut(s) 15
ErhI CCWWGG 1 cut(s) 15
FaeI CATG 1 cut(s) 43
FaiI YATR 8 cut(s) 33, 41, 74, 78, 95, 120, 195, 212
FatI CATG 1 cut(s) 39
Fnu4HI GCNGC 1 cut(s) 102
Fsp4HI GCNGC 1 cut(s) 102
FspBI CTAG 2 cut(s) 153, 182
GluI GCNGC 1 cut(s) 102
GsuI CTGGAG 1 cut(s) 149
Hin1II CATG 1 cut(s) 43
HincII GTYRAC 1 cut(s) 267
HindII GTYRAC 1 cut(s) 267
HinfI GANTC 2 cut(s) 156, 239
Hpy166II GTNNAC 1 cut(s) 267
Hpy188I TCNGA 1 cut(s) 67
Hpy188III TCNNGA 3 cut(s) 128, 160, 249
Hpy8I GTNNAC 1 cut(s) 267
HpyAV CCTTC 2 cut(s) 43, 290
HpyCH4IV ACGT 1 cut(s) 124
HpyCH4V TGCA 2 cut(s) 118, 283
HpyF3I CTNAG 3 cut(s) 64, 261, 326
HpySE526I ACGT 1 cut(s) 124
Hsp92II CATG 1 cut(s) 43
Kzo9I GATC 1 cut(s) 67
LpnPI CCDG 6 cut(s) 113, 173, 234, 288, 315, 335
Lsp1109I GCAGC 1 cut(s) 88
LweI GCATC 1 cut(s) 262
MaeI CTAG 2 cut(s) 153, 182
MaeII ACGT 1 cut(s) 124
MaeIII GTNAC 3 cut(s) 35, 79, 136
MalI GATC 1 cut(s) 69
MboI GATC 1 cut(s) 67
MflI RGATCY 1 cut(s) 67
MluCI AATT 5 cut(s) 59, 113, 163, 176, 231
MlyI GAGTC 2 cut(s) 165, 248
MnlI CCTC 2 cut(s) 136, 321
MspR9I CCNGG 1 cut(s) 303
Mva1269I GAATGC 1 cut(s) 103
MvaI CCWGG 1 cut(s) 303
NdeII GATC 1 cut(s) 67
NlaIII CATG 1 cut(s) 43
NmuCI GTSAC 2 cut(s) 79, 136
NspI RCATGY 1 cut(s) 43
PciI ACATGT 1 cut(s) 39
PctI GAATGC 1 cut(s) 103
PflFI GACNNNGTC 1 cut(s) 262
PflMI CCANNNNNTGG 1 cut(s) 166
PfoI TCCNGGA 1 cut(s) 301
PkrI GCNGC 1 cut(s) 103
PleI GAGTC 2 cut(s) 164, 247
PpsI GAGTC 2 cut(s) 164, 247
PscI ACATGT 1 cut(s) 39
PshAI GACNNNNGTC 1 cut(s) 219
Psp6I CCWGG 1 cut(s) 301
PspGI CCWGG 1 cut(s) 301
PspPI GGNCC 1 cut(s) 299
PsuI RGATCY 1 cut(s) 67
PsyI GACNNNGTC 1 cut(s) 262
SatI GCNGC 1 cut(s) 102
Sau3AI GATC 1 cut(s) 67
Sau96I GGNCC 1 cut(s) 299
SchI GAGTC 2 cut(s) 165, 248
ScrFI CCNGG 1 cut(s) 303
SetI ASST 6 cut(s) 13, 17, 127, 301, 324, 332
SfaNI GCATC 1 cut(s) 262
SinI GGWCC 1 cut(s) 299
Sse9I AATT 5 cut(s) 59, 113, 163, 176, 231
SsiI CCGC 1 cut(s) 236
SspMI CTAG 2 cut(s) 153, 182
StyD4I CCNGG 1 cut(s) 301
StyI CCWWGG 1 cut(s) 15
TaiI ACGT 1 cut(s) 127
TaqI TCGA 2 cut(s) 198, 206
TaqII GACCGA 1 cut(s) 322
TasI AATT 5 cut(s) 59, 113, 163, 176, 231
TseFI GTSAC 2 cut(s) 79, 136
TseI GCWGC 1 cut(s) 101
Tsp45I GTSAC 2 cut(s) 79, 136
TspDTI ATGAA 2 cut(s) 110, 323
Tth111I GACNNNGTC 1 cut(s) 262
Van91I CCANNNNNTGG 1 cut(s) 166
VpaK11BI GGWCC 1 cut(s) 299
XapI RAATTY 2 cut(s) 59, 163
XceI RCATGY 1 cut(s) 43
XspI CTAG 2 cut(s) 153, 182
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.