Prupe.2G096200_v2.0.a1

Ubiquitin exists either covalently attached to another protein, or free (unanchored). When covalently bound, it is conjugated to target proteins via an isopeptide bond either as a monomer (monoubiquitin), a polymer linked via different Lys residues of the ubiquitin (polyubiquitin chains) or a linear polymer linked via the initiator Met of the ubiquitin (linear polyubiquitin chains). Polyubiquitin chains, when attached to a target protein, have different functions depending on the Lys residue of the ubiquitin that is linked

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp02
Physical Location & Seq
Reverse (-)
15129746 .. 15130090
345 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.2G096200.1

Sequence Viewer

Length: 345 bp
ATGCAGATCTTTGGGTTGACACTTACAGGGAAGACCATTCCCCTTGAAGTTGAGAGCTACGACACCATAGACAATGTCAAGGCAAAGATTCAAGACAAAGAGGGAATTCCACCAGACCAGCAGAGGCTTATATTTGCTGGAAAGCAACTAGAGGATGGTAGGACCCTTGCTGATTATAACATCCAGAAGGAATCCACCTTGCATCTTGTTCTCCGTTTGCGAGGTGGTATGCAGATCTTTGTTAAGACCTTGACTGGCAAGACCATCACTCTTGATGTGGAGAGCTCTGATACCATAGACAATGTGTTTTGTGTTTTTGTTTGGCTCTGTCCTGGGGTTTTCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

115

Amino Acids

12.79

Weight (kDa)

5.04

Isoelectric Point (pI)

24.93

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0020129)

Species Orthologous Gene IDs
prunus_persica Prupe.2G096200_v2.0.a1 Prupe.6G189400_v2.0.a1
rosa_chinensis RchiOBHm_Chr4g0396371
rosa_rugosa Rorug03G0349500
rosa_samantha Rh4AG067700 Rh4CG073600

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 177
AcsI RAATTY 1 cut(s) 105
AgsI TTSAA 2 cut(s) 47, 92
AjnI CCWGG 1 cut(s) 331
AluBI AGCT 2 cut(s) 57, 285
AluI AGCT 2 cut(s) 57, 285
Alw21I GWGCWC 1 cut(s) 287
ApoI RAATTY 1 cut(s) 105
AspS9I GGNCC 1 cut(s) 162
AvaII GGWCC 1 cut(s) 162
BanII GRGCYC 1 cut(s) 287
BbsI GAAGAC 1 cut(s) 38
Bbv12I GWGCWC 1 cut(s) 287
BccI CCATC 2 cut(s) 149, 272
BciT130I CCWGG 1 cut(s) 333
BfaI CTAG 2 cut(s) 149, 343
BglII AGATCT 2 cut(s) 6, 234
Bme1390I CCNGG 1 cut(s) 333
Bme18I GGWCC 1 cut(s) 162
BmgT120I GGNCC 1 cut(s) 162
BmiI GGNNCC 1 cut(s) 164
BmrFI CCNGG 1 cut(s) 333
BmsI GCATC 1 cut(s) 211
BpiI GAAGAC 1 cut(s) 38
BsaJI CCNNGG 1 cut(s) 332
Bse1I ACTGG 1 cut(s) 259
BseBI CCWGG 1 cut(s) 333
BseDI CCNNGG 1 cut(s) 332
BseGI GGATG 2 cut(s) 160, 180
BseNI ACTGG 1 cut(s) 259
BsiHKAI GWGCWC 1 cut(s) 287
Bsp1286I GDGCHC 1 cut(s) 287
Bsp143I GATC 2 cut(s) 6, 234
BspLI GGNNCC 1 cut(s) 164
BsrI ACTGG 1 cut(s) 259
BssECI CCNNGG 1 cut(s) 332
BssMI GATC 2 cut(s) 6, 234
Bst2UI CCWGG 1 cut(s) 333
BstF5I GGATG 2 cut(s) 160, 180
BstKTI GATC 2 cut(s) 9, 237
BstMBI GATC 2 cut(s) 6, 234
BstNI CCWGG 1 cut(s) 333
BstSCI CCNGG 1 cut(s) 331
BstV2I GAAGAC 1 cut(s) 38
BstX2I RGATCY 2 cut(s) 6, 234
BstYI RGATCY 2 cut(s) 6, 234
BtsCI GGATG 2 cut(s) 160, 180
Cfr13I GGNCC 1 cut(s) 162
CviJI RGCY 4 cut(s) 57, 127, 285, 325
CviKI_1 RGCY 4 cut(s) 57, 127, 285, 325
DpnI GATC 2 cut(s) 8, 236
DpnII GATC 2 cut(s) 6, 234
Ecl136II GAGCTC 1 cut(s) 285
Eco24I GRGCYC 1 cut(s) 287
Eco47I GGWCC 1 cut(s) 162
Eco53kI GAGCTC 1 cut(s) 285
EcoICRI GAGCTC 1 cut(s) 285
EcoO109I RGGNCCY 1 cut(s) 162
EcoRI GAATTC 1 cut(s) 105
EcoRII CCWGG 1 cut(s) 331
EcoT38I GRGCYC 1 cut(s) 287
FaiI YATR 5 cut(s) 68, 131, 177, 230, 296
FokI GGATG 2 cut(s) 167, 167
FriOI GRGCYC 1 cut(s) 287
FspBI CTAG 2 cut(s) 149, 343
HincII GTYRAC 1 cut(s) 18
HindII GTYRAC 1 cut(s) 18
HinfI GANTC 2 cut(s) 88, 191
Hpy166II GTNNAC 1 cut(s) 18
Hpy188I TCNGA 1 cut(s) 289
Hpy188III TCNNGA 3 cut(s) 92, 184, 272
Hpy8I GTNNAC 1 cut(s) 18
HpyAV CCTTC 1 cut(s) 181
HpyCH4V TGCA 3 cut(s) 4, 202, 232
Kzo9I GATC 2 cut(s) 6, 234
LpnPI CCDG 7 cut(s) 12, 123, 126, 131, 197, 240, 318
LweI GCATC 1 cut(s) 211
MaeI CTAG 2 cut(s) 149, 343
MalI GATC 2 cut(s) 8, 236
MboI GATC 2 cut(s) 6, 234
MboII GAAGA 1 cut(s) 43
MflI RGATCY 2 cut(s) 6, 234
MhlI GDGCHC 1 cut(s) 287
MluCI AATT 1 cut(s) 105
MnlI CCTC 4 cut(s) 94, 117, 145, 215
MseI TTAA 1 cut(s) 243
MspR9I CCNGG 1 cut(s) 333
MvaI CCWGG 1 cut(s) 333
NdeII GATC 2 cut(s) 6, 234
NlaIV GGNNCC 1 cut(s) 164
PfeI GAWTC 2 cut(s) 88, 191
PflFI GACNNNGTC 1 cut(s) 74
PpuMI RGGWCCY 1 cut(s) 162
PsiI TTATAA 1 cut(s) 177
Psp124BI GAGCTC 1 cut(s) 287
Psp5II RGGWCCY 1 cut(s) 162
Psp6I CCWGG 1 cut(s) 331
PspGI CCWGG 1 cut(s) 331
PspN4I GGNNCC 1 cut(s) 164
PspPI GGNCC 1 cut(s) 162
PspPPI RGGWCCY 1 cut(s) 162
PsuI RGATCY 2 cut(s) 6, 234
PsyI GACNNNGTC 1 cut(s) 74
SacI GAGCTC 1 cut(s) 287
SaqAI TTAA 1 cut(s) 243
Sau3AI GATC 2 cut(s) 6, 234
Sau96I GGNCC 1 cut(s) 162
ScrFI CCNGG 1 cut(s) 333
SduI GDGCHC 1 cut(s) 287
SetI ASST 5 cut(s) 59, 200, 226, 251, 287
SfaNI GCATC 1 cut(s) 211
SinI GGWCC 1 cut(s) 162
Sse9I AATT 1 cut(s) 105
SspMI CTAG 2 cut(s) 149, 343
SstI GAGCTC 1 cut(s) 287
StyD4I CCNGG 1 cut(s) 331
TasI AATT 1 cut(s) 105
TfiI GAWTC 2 cut(s) 88, 191
Tru1I TTAA 1 cut(s) 243
Tru9I TTAA 1 cut(s) 243
TspGWI ACGGA 1 cut(s) 203
Tth111I GACNNNGTC 1 cut(s) 74
VpaK11BI GGWCC 1 cut(s) 162
XapI RAATTY 1 cut(s) 105
XspI CTAG 2 cut(s) 149, 343
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.