RchiOBHm_Chr4g0396371

Ubiquitin-2 like Rad60 SUMO-like

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Forward (+)
12544460 .. 12544717
258 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ36874

Sequence Viewer

Length: 258 bp
ATGGCCAAGATCCAGGACAAGGAGAGCATCCTTCCATATCAGCAGAGGCTCATCTTCGCCGGAAAGCAGCTCAAGGATGGCCGAAACCTTGTCGATTACAACATCCAAAAGGAATCGATCCTCCATCTGATCCTCCGTCTCCGGGGAGGTATGCAGATCTTCGTCAAAACCCACAAAATAAAGAGGGCAAATTATTATGTCGGATTGGCTCTCGGCTTCAACATTAAAACTGTCATTACTCTAGGCTTCATCTCGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

85

Amino Acids

9.79

Weight (kDa)

10.19

Isoelectric Point (pI)

46.11

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
ubiquitin PF00240 1 - 48 1.7e-14 Ubiquitin family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0020129)

Species Orthologous Gene IDs
prunus_persica Prupe.2G096200_v2.0.a1 Prupe.6G189400_v2.0.a1
rosa_chinensis RchiOBHm_Chr4g0396371
rosa_rugosa Rorug03G0349500
rosa_samantha Rh4AG067700 Rh4CG073600

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 3 cut(s) 4, 112, 124
AcoI YGGCCR 2 cut(s) 3, 79
AfiI CCNNNNNNNGG 2 cut(s) 19, 142
AgsI TTSAA 1 cut(s) 220
AjnI CCWGG 1 cut(s) 12
AluBI AGCT 1 cut(s) 70
AluI AGCT 1 cut(s) 70
Alw26I GTCTC 1 cut(s) 143
AlwI GGATC 3 cut(s) 4, 112, 124
AoxI GGCC 2 cut(s) 3, 79
ApeKI GCWGC 1 cut(s) 67
AsuC2I CCSGG 1 cut(s) 143
BalI TGGCCA 1 cut(s) 5
BbvI GCAGC 1 cut(s) 79
BccI CCATC 2 cut(s) 71, 132
BciT130I CCWGG 1 cut(s) 14
BcnI CCSGG 1 cut(s) 143
BcoDI GTCTC 1 cut(s) 143
BfaI CTAG 1 cut(s) 242
BglII AGATCT 1 cut(s) 156
BisI GCNGC 1 cut(s) 68
BlsI GCNGC 1 cut(s) 69
Bme1390I CCNGG 2 cut(s) 14, 143
BmrFI CCNGG 2 cut(s) 14, 143
BmsI GCATC 1 cut(s) 36
BpuEI CTTGAG 1 cut(s) 56
BpuMI CCSGG 1 cut(s) 143
Bsa29I ATCGAT 1 cut(s) 116
BsaJI CCNNGG 1 cut(s) 142
Bsc4I CCNNNNNNNGG 2 cut(s) 19, 142
BseBI CCWGG 1 cut(s) 14
BseCI ATCGAT 1 cut(s) 116
BseDI CCNNGG 1 cut(s) 142
BseGI GGATG 3 cut(s) 27, 82, 102
BseLI CCNNNNNNNGG 2 cut(s) 19, 142
BseXI GCAGC 1 cut(s) 79
BshFI GGCC 2 cut(s) 5, 81
BshVI ATCGAT 1 cut(s) 116
BsiSI CCGG 2 cut(s) 60, 142
BslI CCNNNNNNNGG 2 cut(s) 19, 142
BsmAI GTCTC 1 cut(s) 143
BsmBI CGTCTC 1 cut(s) 143
BsnI GGCC 2 cut(s) 5, 81
Bsp143I GATC 4 cut(s) 9, 117, 129, 156
BspANI GGCC 2 cut(s) 5, 81
BspDI ATCGAT 1 cut(s) 116
BspPI GGATC 3 cut(s) 4, 112, 124
BssECI CCNNGG 1 cut(s) 142
BssMI GATC 4 cut(s) 9, 117, 129, 156
Bst2UI CCWGG 1 cut(s) 14
Bst4CI ACNGT 1 cut(s) 232
BstF5I GGATG 3 cut(s) 27, 82, 102
BstKTI GATC 4 cut(s) 12, 120, 132, 159
BstMAI GTCTC 1 cut(s) 143
BstMBI GATC 4 cut(s) 9, 117, 129, 156
BstNI CCWGG 1 cut(s) 14
BstSCI CCNGG 2 cut(s) 12, 141
BstV1I GCAGC 1 cut(s) 79
BstX2I RGATCY 2 cut(s) 9, 156
BstYI RGATCY 2 cut(s) 9, 156
Bsu15I ATCGAT 1 cut(s) 116
BsuRI GGCC 2 cut(s) 5, 81
BsuTUI ATCGAT 1 cut(s) 116
BtsCI GGATG 3 cut(s) 27, 82, 102
ClaI ATCGAT 1 cut(s) 116
CviJI RGCY 7 cut(s) 5, 49, 70, 81, 209, 216, 246
CviKI_1 RGCY 7 cut(s) 5, 49, 70, 81, 209, 216, 246
DpnI GATC 4 cut(s) 11, 119, 131, 158
DpnII GATC 4 cut(s) 9, 117, 129, 156
EaeI YGGCCR 2 cut(s) 3, 79
EcoRII CCWGG 1 cut(s) 12
Esp3I CGTCTC 1 cut(s) 143
FaiI YATR 3 cut(s) 37, 152, 198
Fnu4HI GCNGC 1 cut(s) 68
FokI GGATG 3 cut(s) 14, 89, 89
Fsp4HI GCNGC 1 cut(s) 68
FspBI CTAG 1 cut(s) 242
GluI GCNGC 1 cut(s) 68
HaeIII GGCC 2 cut(s) 5, 81
HapII CCGG 2 cut(s) 60, 142
HinfI GANTC 1 cut(s) 113
HpaII CCGG 2 cut(s) 60, 142
Hpy188I TCNGA 2 cut(s) 129, 203
HpyAV CCTTC 1 cut(s) 41
HpyCH4III ACNGT 1 cut(s) 232
HpyCH4V TGCA 1 cut(s) 154
Kzo9I GATC 4 cut(s) 9, 117, 129, 156
LpnPI CCDG 3 cut(s) 26, 73, 155
Lsp1109I GCAGC 1 cut(s) 79
LweI GCATC 1 cut(s) 36
MaeI CTAG 1 cut(s) 242
MalI GATC 4 cut(s) 11, 119, 131, 158
MboI GATC 4 cut(s) 9, 117, 129, 156
MboII GAAGA 2 cut(s) 46, 151
MflI RGATCY 2 cut(s) 9, 156
MlsI TGGCCA 1 cut(s) 5
MluCI AATT 1 cut(s) 190
MluNI TGGCCA 1 cut(s) 5
MmeI TCCRAC 1 cut(s) 181
MnlI CCTC 5 cut(s) 39, 131, 140, 143, 177
Mox20I TGGCCA 1 cut(s) 5
MscI TGGCCA 1 cut(s) 5
MseI TTAA 1 cut(s) 225
Msp20I TGGCCA 1 cut(s) 5
MspI CCGG 2 cut(s) 60, 142
MspR9I CCNGG 2 cut(s) 14, 143
MvaI CCWGG 1 cut(s) 14
NciI CCSGG 1 cut(s) 143
NdeII GATC 4 cut(s) 9, 117, 129, 156
NmeAIII GCCGAG 1 cut(s) 192
PfeI GAWTC 1 cut(s) 113
PfoI TCCNGGA 1 cut(s) 12
PkrI GCNGC 1 cut(s) 69
Psp6I CCWGG 1 cut(s) 12
PspGI CCWGG 1 cut(s) 12
PsuI RGATCY 2 cut(s) 9, 156
SaqAI TTAA 1 cut(s) 225
SatI GCNGC 1 cut(s) 68
Sau3AI GATC 4 cut(s) 9, 117, 129, 156
ScrFI CCNGG 2 cut(s) 14, 143
SetI ASST 3 cut(s) 72, 90, 151
SfaNI GCATC 1 cut(s) 36
SmlI CTYRAG 1 cut(s) 71
SmoI CTYRAG 1 cut(s) 71
Sse9I AATT 1 cut(s) 190
SspMI CTAG 1 cut(s) 242
StyD4I CCNGG 2 cut(s) 12, 141
TaaI ACNGT 1 cut(s) 232
TaqI TCGA 2 cut(s) 93, 116
TasI AATT 1 cut(s) 190
TfiI GAWTC 1 cut(s) 113
Tru1I TTAA 1 cut(s) 225
Tru9I TTAA 1 cut(s) 225
TseI GCWGC 1 cut(s) 67
TspDTI ATGAA 1 cut(s) 238
TspGWI ACGGA 1 cut(s) 125
XspI CTAG 1 cut(s) 242
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.