Prupe.3G228800_v2.0.a1

Wound-induced protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp03
OG0019255
Physical Location & Seq
Forward (+)
22754148 .. 22755545
1398 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.3G228800.1_v2.0.a1.CDS.1

Sequence Viewer

Length: 255 bp
ATGATGCAAGGAACTAATGGCCAAGCTGCTGCTTCTGCTTCTTCTCCTAAAGGCAACTACTCTGTCTCATCTTCTACTAGGCCAACTATAGCAGAAGTTTATGGTGGTCTTACACCAAAAGTACTTTTCAATAAAGCTACTGCTAACAACAGCACTACTACTAGTGATCAAACTCATCAAAGGCTTAAACAGCTGCAGGCAGAAGAATCGCTTCGCACTGTCATGTACTTGAGCTGCTGGGGTCCTAACACATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF3774

Protein Analysis

85

Amino Acids

8.97

Weight (kDa)

9.36

Isoelectric Point (pI)

39.23

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019255)

Species Orthologous Gene IDs
fragaria_vesca FvH4_6g44430
prunus_persica Prupe.3G228800_v2.0.a1
rosa_roxburghii Rroxscaffold_2G00088850
rosa_rugosa Rorug02G0489300
rosa_samantha Rh2AG555500 Rh2BG568700 Rh2CG539400 Rh2DG578300

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 19
AfaI GTAC 2 cut(s) 123, 227
AgsI TTSAA 1 cut(s) 130
AhlI ACTAGT 1 cut(s) 161
AluBI AGCT 4 cut(s) 26, 137, 193, 234
AluI AGCT 4 cut(s) 26, 137, 193, 234
Alw26I GTCTC 1 cut(s) 70
AoxI GGCC 2 cut(s) 19, 80
ApeKI GCWGC 4 cut(s) 26, 29, 193, 234
Asp700I GAANNNNTTC 1 cut(s) 210
AspS9I GGNCC 1 cut(s) 242
AvaII GGWCC 1 cut(s) 242
BalI TGGCCA 1 cut(s) 21
BbvI GCAGC 4 cut(s) 13, 16, 180, 221
BcgI CGANNNNNNTGC 2 cut(s) 189, 223
BclI TGATCA 1 cut(s) 166
BcoDI GTCTC 1 cut(s) 70
BcuI ACTAGT 1 cut(s) 161
BfaI CTAG 2 cut(s) 78, 162
BfmI CTRYAG 2 cut(s) 87, 194
BisI GCNGC 4 cut(s) 27, 30, 194, 235
BlsI GCNGC 4 cut(s) 28, 31, 195, 236
BmcAI AGTACT 1 cut(s) 123
Bme18I GGWCC 1 cut(s) 242
BmgT120I GGNCC 1 cut(s) 242
BmiI GGNNCC 1 cut(s) 243
BpuEI CTTGAG 1 cut(s) 250
BseXI GCAGC 4 cut(s) 13, 16, 180, 221
BseYI CCCAGC 1 cut(s) 237
BshFI GGCC 2 cut(s) 21, 82
BsmAI GTCTC 1 cut(s) 70
BsnI GGCC 2 cut(s) 21, 82
Bsp143I GATC 1 cut(s) 166
BspANI GGCC 2 cut(s) 21, 82
BspLI GGNNCC 1 cut(s) 243
BspMAI CTGCAG 1 cut(s) 198
BssMI GATC 1 cut(s) 166
Bst4CI ACNGT 1 cut(s) 220
BstC8I GCNNGC 1 cut(s) 198
BstKTI GATC 1 cut(s) 169
BstMAI GTCTC 1 cut(s) 70
BstMBI GATC 1 cut(s) 166
BstMWI GCNNNNNNNGC 2 cut(s) 35, 190
BstSFI CTRYAG 2 cut(s) 87, 194
BstV1I GCAGC 4 cut(s) 13, 16, 180, 221
BsuRI GGCC 2 cut(s) 21, 82
BtsIMutI CAGTG 1 cut(s) 216
Cac8I GCNNGC 1 cut(s) 198
Cfr13I GGNCC 1 cut(s) 242
Csp6I GTAC 2 cut(s) 122, 226
CviAII CATG 2 cut(s) 223, 252
CviJI RGCY 7 cut(s) 21, 26, 82, 137, 184, 193, 234
CviKI_1 RGCY 7 cut(s) 21, 26, 82, 137, 184, 193, 234
CviQI GTAC 2 cut(s) 122, 226
DpnI GATC 1 cut(s) 168
DpnII GATC 1 cut(s) 166
EaeI YGGCCR 1 cut(s) 19
Eco47I GGWCC 1 cut(s) 242
EcoO109I RGGNCCY 1 cut(s) 242
FaeI CATG 2 cut(s) 226, 255
FaiI YATR 4 cut(s) 89, 102, 224, 253
FalI AAGNNNNNCTT 2 cut(s) 195, 227
FatI CATG 2 cut(s) 222, 251
FbaI TGATCA 1 cut(s) 166
Fnu4HI GCNGC 4 cut(s) 27, 30, 194, 235
Fsp4HI GCNGC 4 cut(s) 27, 30, 194, 235
FspBI CTAG 2 cut(s) 78, 162
GluI GCNGC 4 cut(s) 27, 30, 194, 235
GsaI CCCAGC 1 cut(s) 241
HaeIII GGCC 2 cut(s) 21, 82
Hin1II CATG 2 cut(s) 226, 255
HinfI GANTC 1 cut(s) 206
HpyCH4III ACNGT 1 cut(s) 220
HpyCH4V TGCA 2 cut(s) 7, 196
HpyF10VI GCNNNNNNNGC 2 cut(s) 35, 190
Hsp92II CATG 2 cut(s) 226, 255
Ksp22I TGATCA 1 cut(s) 166
Kzo9I GATC 1 cut(s) 166
LpnPI CCDG 2 cut(s) 182, 223
Lsp1109I GCAGC 4 cut(s) 13, 16, 180, 221
MaeI CTAG 2 cut(s) 78, 162
MalI GATC 1 cut(s) 168
MboI GATC 1 cut(s) 166
MboII GAAGA 3 cut(s) 33, 63, 215
MlsI TGGCCA 1 cut(s) 21
MluNI TGGCCA 1 cut(s) 21
Mox20I TGGCCA 1 cut(s) 21
MroXI GAANNNNTTC 1 cut(s) 210
MscI TGGCCA 1 cut(s) 21
MseI TTAA 1 cut(s) 186
MslI CAYNNNNRTG 1 cut(s) 221
Msp20I TGGCCA 1 cut(s) 21
MspA1I CMGCKG 1 cut(s) 193
MwoI GCNNNNNNNGC 2 cut(s) 35, 190
NdeII GATC 1 cut(s) 166
NlaIII CATG 2 cut(s) 226, 255
NlaIV GGNNCC 1 cut(s) 243
PdmI GAANNNNTTC 1 cut(s) 210
PfeI GAWTC 1 cut(s) 206
PkrI GCNGC 4 cut(s) 28, 31, 195, 236
PpuMI RGGWCCY 1 cut(s) 242
Psp5II RGGWCCY 1 cut(s) 242
PspFI CCCAGC 1 cut(s) 237
PspN4I GGNNCC 1 cut(s) 243
PspPI GGNCC 1 cut(s) 242
PspPPI RGGWCCY 1 cut(s) 242
PstI CTGCAG 1 cut(s) 198
PvuII CAGCTG 1 cut(s) 193
RsaI GTAC 2 cut(s) 123, 227
RsaNI GTAC 2 cut(s) 122, 226
RseI CAYNNNNRTG 1 cut(s) 221
SaqAI TTAA 1 cut(s) 186
SatI GCNGC 4 cut(s) 27, 30, 194, 235
Sau3AI GATC 1 cut(s) 166
Sau96I GGNCC 1 cut(s) 242
ScaI AGTACT 1 cut(s) 123
SetI ASST 4 cut(s) 28, 139, 195, 236
SfcI CTRYAG 2 cut(s) 87, 194
SgeI CNNG 8 cut(s) 20, 35, 90, 174, 209, 235, 241, 250
SinI GGWCC 1 cut(s) 242
SmiMI CAYNNNNRTG 1 cut(s) 221
SmlI CTYRAG 1 cut(s) 229
SmoI CTYRAG 1 cut(s) 229
SpeI ACTAGT 1 cut(s) 161
SspMI CTAG 2 cut(s) 78, 162
TaaI ACNGT 1 cut(s) 220
TatI WGTACW 2 cut(s) 121, 225
TfiI GAWTC 1 cut(s) 206
Tru1I TTAA 1 cut(s) 186
Tru9I TTAA 1 cut(s) 186
TscAI CASTG 1 cut(s) 223
TseI GCWGC 4 cut(s) 26, 29, 193, 234
TspRI CASTG 1 cut(s) 223
VpaK11BI GGWCC 1 cut(s) 242
XmnI GAANNNNTTC 1 cut(s) 210
XspI CTAG 2 cut(s) 78, 162
ZrmI AGTACT 1 cut(s) 123
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.