Prupe.3G266100_v2.0.a1

No description available

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp03
Physical Location & Seq
Reverse (-)
24943715 .. 24944941
1227 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.3G266100.1

Sequence Viewer

Length: 243 bp
ATGGGCCGTCCTTGGTTTTTAAGAGTTTTCATAGTTTCTTGCCTTCTGGCTCTCTGTTTCTCTCATGGATTTGGGAGAAACCTGATGGGGACTATTGATCTTGAAGATTTTTCAGTTCTAGTGTCAAAGGAAACGCATGGAAAGCCCAGGAAAATGATCACAGTGATGGATTATGCAGATCCAGAGCCAAATGTTAACCCCAGAACAGGGTATATCTTTACCCCTCCTCCGCAGCCCAACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

81

Amino Acids

9.07

Weight (kDa)

7.83

Isoelectric Point (pI)

32.92

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015887)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G15265 AT5G15265
fragaria_vesca FvH4_6g48260
malus_domestica MD00G1125200.v1.1 MD09G1052600.v1.1
prunus_persica Prupe.3G266100_v2.0.a1 Prupe.3G266100_v2.0.a1
pyrus_communis pycom17g04810
rosa_chinensis RchiOBHm_Chr2g0167761
rosa_multiflora Rmu_co8387187.1_g000001 Rmu_sc0042171.1_g000002
rosa_roxburghii Rroxscaffold_2G00083280
rosa_rugosa Rorug02G0531900
rosa_samantha Rh2BG611500
rosa_wichuraiana Rw2G049880

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 230
AclWI GGATC 1 cut(s) 173
AfiI CCNNNNNNNGG 2 cut(s) 206, 207
AgsI TTSAA 1 cut(s) 104
AjnI CCWGG 1 cut(s) 146
AlwI GGATC 1 cut(s) 173
AoxI GGCC 1 cut(s) 4
ApeKI GCWGC 1 cut(s) 232
AspS9I GGNCC 1 cut(s) 4
BccI CCATC 2 cut(s) 79, 160
BciT130I CCWGG 1 cut(s) 148
BclI TGATCA 1 cut(s) 156
BfaI CTAG 1 cut(s) 119
BisI GCNGC 1 cut(s) 233
BlsI GCNGC 1 cut(s) 234
Bme1390I CCNGG 1 cut(s) 148
BmgT120I GGNCC 1 cut(s) 4
BmrFI CCNGG 1 cut(s) 148
BsaJI CCNNGG 2 cut(s) 11, 146
BsaXI ACNNNNNCTCC 2 cut(s) 211, 241
Bsc4I CCNNNNNNNGG 2 cut(s) 206, 207
BseBI CCWGG 1 cut(s) 148
BseDI CCNNGG 2 cut(s) 11, 146
BseLI CCNNNNNNNGG 2 cut(s) 206, 207
BseRI GAGGAG 1 cut(s) 216
BshFI GGCC 1 cut(s) 6
BslFI GGGAC 1 cut(s) 103
BslI CCNNNNNNNGG 2 cut(s) 206, 207
BsmFI GGGAC 1 cut(s) 103
BsnI GGCC 1 cut(s) 6
Bsp143I GATC 3 cut(s) 97, 156, 178
BspACI CCGC 1 cut(s) 230
BspANI GGCC 1 cut(s) 6
BspPI GGATC 1 cut(s) 173
BssECI CCNNGG 2 cut(s) 11, 146
BssMI GATC 3 cut(s) 97, 156, 178
BssT1I CCWWGG 1 cut(s) 11
Bst2UI CCWGG 1 cut(s) 148
Bst4CI ACNGT 1 cut(s) 163
BstKTI GATC 3 cut(s) 100, 159, 181
BstMBI GATC 3 cut(s) 97, 156, 178
BstMWI GCNNNNNNNGC 1 cut(s) 142
BstNI CCWGG 1 cut(s) 148
BstSCI CCNGG 1 cut(s) 146
BstX2I RGATCY 1 cut(s) 178
BstYI RGATCY 1 cut(s) 178
BsuRI GGCC 1 cut(s) 6
BtsIMutI CAGTG 1 cut(s) 168
Cfr13I GGNCC 1 cut(s) 4
CviAII CATG 2 cut(s) 65, 137
CviJI RGCY 5 cut(s) 6, 50, 145, 187, 235
CviKI_1 RGCY 5 cut(s) 6, 50, 145, 187, 235
DpnI GATC 3 cut(s) 99, 158, 180
DpnII GATC 3 cut(s) 97, 156, 178
Eco130I CCWWGG 1 cut(s) 11
EcoRII CCWGG 1 cut(s) 146
EcoT14I CCWWGG 1 cut(s) 11
ErhI CCWWGG 1 cut(s) 11
FaeI CATG 2 cut(s) 68, 140
FaiI YATR 5 cut(s) 32, 66, 138, 174, 213
FaqI GGGAC 1 cut(s) 103
FatI CATG 2 cut(s) 64, 136
FbaI TGATCA 1 cut(s) 156
Fnu4HI GCNGC 1 cut(s) 233
Fsp4HI GCNGC 1 cut(s) 233
FspBI CTAG 1 cut(s) 119
GluI GCNGC 1 cut(s) 233
HaeIII GGCC 1 cut(s) 6
Hin1II CATG 2 cut(s) 68, 140
HincII GTYRAC 1 cut(s) 196
HindII GTYRAC 1 cut(s) 196
HpaI GTTAAC 1 cut(s) 196
Hpy166II GTNNAC 1 cut(s) 196
Hpy188III TCNNGA 2 cut(s) 101, 182
Hpy8I GTNNAC 1 cut(s) 196
HpyAV CCTTC 1 cut(s) 53
HpyCH4III ACNGT 1 cut(s) 163
HpyCH4V TGCA 1 cut(s) 176
HpyF10VI GCNNNNNNNGC 1 cut(s) 142
Hsp92II CATG 2 cut(s) 68, 140
Ksp22I TGATCA 1 cut(s) 156
KspAI GTTAAC 1 cut(s) 196
Kzo9I GATC 3 cut(s) 97, 156, 178
LpnPI CCDG 7 cut(s) 32, 95, 133, 160, 192, 195, 214
MaeI CTAG 1 cut(s) 119
MalI GATC 3 cut(s) 99, 158, 180
MboI GATC 3 cut(s) 97, 156, 178
MboII GAAGA 1 cut(s) 116
MflI RGATCY 1 cut(s) 178
MnlI CCTC 2 cut(s) 234, 237
MseI TTAA 2 cut(s) 20, 195
MslI CAYNNNNRTG 1 cut(s) 164
MspR9I CCNGG 1 cut(s) 148
MvaI CCWGG 1 cut(s) 148
MwoI GCNNNNNNNGC 1 cut(s) 142
NdeII GATC 3 cut(s) 97, 156, 178
NlaIII CATG 2 cut(s) 68, 140
PkrI GCNGC 1 cut(s) 234
Psp6I CCWGG 1 cut(s) 146
PspGI CCWGG 1 cut(s) 146
PspPI GGNCC 1 cut(s) 4
PsuI RGATCY 1 cut(s) 178
RseI CAYNNNNRTG 1 cut(s) 164
SaqAI TTAA 2 cut(s) 20, 195
SatI GCNGC 1 cut(s) 233
Sau3AI GATC 3 cut(s) 97, 156, 178
Sau96I GGNCC 1 cut(s) 4
ScrFI CCNGG 1 cut(s) 148
SetI ASST 1 cut(s) 84
SmiMI CAYNNNNRTG 1 cut(s) 164
SsiI CCGC 1 cut(s) 230
SspMI CTAG 1 cut(s) 119
StyD4I CCNGG 1 cut(s) 146
StyI CCWWGG 1 cut(s) 11
TaaI ACNGT 1 cut(s) 163
Tru1I TTAA 2 cut(s) 20, 195
Tru9I TTAA 2 cut(s) 20, 195
TscAI CASTG 1 cut(s) 168
TseI GCWGC 1 cut(s) 232
TspDTI ATGAA 1 cut(s) 19
TspRI CASTG 1 cut(s) 168
XspI CTAG 1 cut(s) 119
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.