Rh2BG611500

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2B
Physical Location & Seq
Reverse (-)
83180372 .. 83180800
429 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2BG611500.1

Sequence Viewer

Length: 246 bp
ATGATGGGTCGGCCTTGGTTTCTCAGAGTTCTCACAGTTTCATGCTTTCTGGCTCTCTTTTTCTCTCAAGGATTTGGGAGAAACTTGATTGAGAGAGGTGATCAGCATGAGGACTCTTCATTCCAAACAGAGGAAATTGATCCAAGTGTAAGGAAGCTGTATGAAGTGATGGACTATCCAGATCCAGAGCCAAATGTGAACCCAAGAACAGGGAACCTCTTCACCCCTCCTCCTCAGCCCAACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

81

Amino Acids

9.37

Weight (kDa)

4.72

Isoelectric Point (pI)

53.78

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015887)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G15265 AT5G15265
fragaria_vesca FvH4_6g48260
malus_domestica MD00G1125200.v1.1 MD09G1052600.v1.1
prunus_persica Prupe.3G266100_v2.0.a1 Prupe.3G266100_v2.0.a1
pyrus_communis pycom17g04810
rosa_chinensis RchiOBHm_Chr2g0167761
rosa_multiflora Rmu_co8387187.1_g000001 Rmu_sc0042171.1_g000002
rosa_roxburghii Rroxscaffold_2G00083280
rosa_rugosa Rorug02G0531900
rosa_samantha Rh2BG611500
rosa_wichuraiana Rw2G049880

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 134, 176
AfiI CCNNNNNNNGG 2 cut(s) 130, 209
AluBI AGCT 1 cut(s) 157
AluI AGCT 1 cut(s) 157
AlwI GGATC 2 cut(s) 134, 176
AoxI GGCC 1 cut(s) 11
Asp700I GAANNNNTTC 1 cut(s) 218
AsuHPI GGTGA 2 cut(s) 110, 214
BbvCI CCTCAGC 1 cut(s) 234
BccI CCATC 1 cut(s) 163
BclI TGATCA 1 cut(s) 100
BmiI GGNNCC 1 cut(s) 215
Bpu10I CCTNAGC 1 cut(s) 234
BpuEI CTTGAG 1 cut(s) 51
BsaJI CCNNGG 1 cut(s) 14
BsaXI ACNNNNNCTCC 2 cut(s) 214, 244
Bsc4I CCNNNNNNNGG 2 cut(s) 130, 209
BseDI CCNNGG 1 cut(s) 14
BseLI CCNNNNNNNGG 2 cut(s) 130, 209
BseMII CTCAG 1 cut(s) 37
BseRI GAGGAG 2 cut(s) 219, 222
BshFI GGCC 1 cut(s) 13
BslI CCNNNNNNNGG 2 cut(s) 130, 209
BsnI GGCC 1 cut(s) 13
Bsp143I GATC 3 cut(s) 100, 139, 181
BspANI GGCC 1 cut(s) 13
BspCNI CTCAG 1 cut(s) 36
BspLI GGNNCC 1 cut(s) 215
BspPI GGATC 2 cut(s) 134, 176
BssECI CCNNGG 1 cut(s) 14
BssMI GATC 3 cut(s) 100, 139, 181
BssT1I CCWWGG 1 cut(s) 14
Bst4CI ACNGT 1 cut(s) 37
Bst6I CTCTTC 2 cut(s) 121, 224
BstDEI CTNAG 2 cut(s) 23, 234
BstKTI GATC 3 cut(s) 103, 142, 184
BstMBI GATC 3 cut(s) 100, 139, 181
BstX2I RGATCY 1 cut(s) 181
BstYI RGATCY 1 cut(s) 181
BsuRI GGCC 1 cut(s) 13
CviAII CATG 2 cut(s) 42, 107
CviJI RGCY 5 cut(s) 13, 53, 157, 190, 238
CviKI_1 RGCY 5 cut(s) 13, 53, 157, 190, 238
DdeI CTNAG 2 cut(s) 23, 234
DpnI GATC 3 cut(s) 102, 141, 183
DpnII GATC 3 cut(s) 100, 139, 181
Eam1104I CTCTTC 2 cut(s) 121, 224
EarI CTCTTC 2 cut(s) 121, 224
Eco130I CCWWGG 1 cut(s) 14
EcoT14I CCWWGG 1 cut(s) 14
ErhI CCWWGG 1 cut(s) 14
FaeI CATG 2 cut(s) 45, 110
FaiI YATR 3 cut(s) 43, 108, 162
FatI CATG 2 cut(s) 41, 106
FbaI TGATCA 1 cut(s) 100
HaeIII GGCC 1 cut(s) 13
Hin1II CATG 2 cut(s) 45, 110
HinfI GANTC 1 cut(s) 113
HphI GGTGA 2 cut(s) 110, 214
Hpy166II GTNNAC 1 cut(s) 199
Hpy188I TCNGA 1 cut(s) 26
Hpy188III TCNNGA 2 cut(s) 179, 185
Hpy8I GTNNAC 1 cut(s) 199
HpyCH4III ACNGT 1 cut(s) 37
HpyF3I CTNAG 2 cut(s) 23, 234
Hsp92II CATG 2 cut(s) 45, 110
Ksp22I TGATCA 1 cut(s) 100
Kzo9I GATC 3 cut(s) 100, 139, 181
LpnPI CCDG 4 cut(s) 35, 192, 195, 198
MalI GATC 3 cut(s) 102, 141, 183
MboI GATC 3 cut(s) 100, 139, 181
MboII GAAGA 2 cut(s) 108, 211
MflI RGATCY 1 cut(s) 181
MluCI AATT 1 cut(s) 135
MlyI GAGTC 1 cut(s) 107
MnlI CCTC 7 cut(s) 89, 103, 124, 227, 237, 240, 243
MroXI GAANNNNTTC 1 cut(s) 218
NdeII GATC 3 cut(s) 100, 139, 181
NlaIII CATG 2 cut(s) 45, 110
NlaIV GGNNCC 1 cut(s) 215
PdmI GAANNNNTTC 1 cut(s) 218
PleI GAGTC 1 cut(s) 107
PpsI GAGTC 1 cut(s) 107
PspN4I GGNNCC 1 cut(s) 215
PsuI RGATCY 1 cut(s) 181
Sau3AI GATC 3 cut(s) 100, 139, 181
SchI GAGTC 1 cut(s) 107
SetI ASST 3 cut(s) 100, 159, 219
SmlI CTYRAG 1 cut(s) 66
SmoI CTYRAG 1 cut(s) 66
Sse9I AATT 1 cut(s) 135
StyI CCWWGG 1 cut(s) 14
TaaI ACNGT 1 cut(s) 37
TasI AATT 1 cut(s) 135
TspDTI ATGAA 3 cut(s) 30, 108, 177
XmnI GAANNNNTTC 1 cut(s) 218
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.