Prupe.7G144800_v2.0.a1

No description available

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp07
Physical Location & Seq
Forward (+)
15852264 .. 15853986
1723 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.7G144800.1

Sequence Viewer

Length: 312 bp
ATGGCTTTCATCATTTCTAAAGCTCCACCACAACAAAAGCAACCATCTTTCTCAGAAGCTGAGAAGAAAGATGGGCATGAAGAACTCTCAGAAGCACAGAGTTCTTCCATCACCAGGCATGTCTACTTGAAATCATCTGCTGCTGCTGCCATGGACAGAGATGTTGTTCTTCGACGCATTCGTCACCACAAGAACTTGAGCAAGGTCAAAAGTGCTTTTCAAGCTCTGATGGGCAGCTCACAGGAAGCTGCTTCTATGGCCTCAGTGGACCAGACATGGCTGCACCAGGAGGACATTTTCTCTTCCCCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

104

Amino Acids

11.44

Weight (kDa)

8.1

Isoelectric Point (pI)

66.44

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0016732)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 180
AccI GTMKAC 1 cut(s) 123
AfiI CCNNNNNNNGG 1 cut(s) 114
AgsI TTSAA 2 cut(s) 130, 221
AjnI CCWGG 2 cut(s) 113, 285
AluBI AGCT 5 cut(s) 23, 59, 224, 237, 248
AluI AGCT 5 cut(s) 23, 59, 224, 237, 248
AlwNI CAGNNNCTG 1 cut(s) 59
AoxI GGCC 1 cut(s) 258
ApeKI GCWGC 6 cut(s) 140, 143, 146, 234, 248, 280
AspS9I GGNCC 1 cut(s) 268
AsuHPI GGTGA 2 cut(s) 103, 176
AvaII GGWCC 1 cut(s) 268
BbvI GCAGC 6 cut(s) 127, 130, 133, 235, 246, 267
BccI CCATC 4 cut(s) 52, 65, 116, 223
BciT130I CCWGG 2 cut(s) 115, 287
BisI GCNGC 6 cut(s) 141, 144, 147, 235, 249, 281
BlsI GCNGC 6 cut(s) 142, 145, 148, 236, 250, 282
Bme1390I CCNGG 2 cut(s) 115, 287
Bme18I GGWCC 1 cut(s) 268
BmgT120I GGNCC 1 cut(s) 268
BmrFI CCNGG 2 cut(s) 115, 287
BpuEI CTTGAG 1 cut(s) 217
BsaJI CCNNGG 1 cut(s) 150
Bsc4I CCNNNNNNNGG 1 cut(s) 114
BseBI CCWGG 2 cut(s) 115, 287
BseDI CCNNGG 1 cut(s) 150
BseLI CCNNNNNNNGG 1 cut(s) 114
BseMII CTCAG 4 cut(s) 51, 66, 102, 276
BseXI GCAGC 6 cut(s) 127, 130, 133, 235, 246, 267
BsgI GTGCAG 1 cut(s) 266
BshFI GGCC 1 cut(s) 260
BslI CCNNNNNNNGG 1 cut(s) 114
BsmI GAATGC 1 cut(s) 177
BsnI GGCC 1 cut(s) 260
Bsp19I CCATGG 1 cut(s) 150
BspANI GGCC 1 cut(s) 260
BspCNI CTCAG 4 cut(s) 52, 65, 101, 275
BssECI CCNNGG 1 cut(s) 150
BssT1I CCWWGG 1 cut(s) 150
Bst2UI CCWGG 2 cut(s) 115, 287
Bst6I CTCTTC 1 cut(s) 307
BstDEI CTNAG 4 cut(s) 52, 60, 88, 262
BstDSI CCRYGG 1 cut(s) 150
BstMWI GCNNNNNNNGC 3 cut(s) 146, 221, 257
BstNI CCWGG 2 cut(s) 115, 287
BstNSI RCATGY 1 cut(s) 122
BstSCI CCNGG 2 cut(s) 113, 285
BstV1I GCAGC 6 cut(s) 127, 130, 133, 235, 246, 267
BsuRI GGCC 1 cut(s) 260
BtgI CCRYGG 1 cut(s) 150
BtsIMutI CAGTG 1 cut(s) 270
CaiI CAGNNNCTG 1 cut(s) 59
Cfr13I GGNCC 1 cut(s) 268
CseI GACGC 1 cut(s) 183
CviAII CATG 4 cut(s) 77, 119, 151, 276
CviJI RGCY 8 cut(s) 5, 23, 59, 224, 237, 248, 260, 280
CviKI_1 RGCY 8 cut(s) 5, 23, 59, 224, 237, 248, 260, 280
DdeI CTNAG 4 cut(s) 52, 60, 88, 262
DrdI GACNNNNNNGTC 1 cut(s) 180
DseDI GACNNNNNNGTC 1 cut(s) 180
Eam1104I CTCTTC 1 cut(s) 307
EarI CTCTTC 1 cut(s) 307
Eco130I CCWWGG 1 cut(s) 150
Eco47I GGWCC 1 cut(s) 268
EcoRII CCWGG 2 cut(s) 113, 285
EcoT14I CCWWGG 1 cut(s) 150
ErhI CCWWGG 1 cut(s) 150
FaeI CATG 4 cut(s) 80, 122, 154, 279
FaiI YATR 5 cut(s) 78, 120, 152, 257, 277
FatI CATG 4 cut(s) 76, 118, 150, 275
FblI GTMKAC 1 cut(s) 123
Fnu4HI GCNGC 6 cut(s) 141, 144, 147, 235, 249, 281
Fsp4HI GCNGC 6 cut(s) 141, 144, 147, 235, 249, 281
GluI GCNGC 6 cut(s) 141, 144, 147, 235, 249, 281
HaeIII GGCC 1 cut(s) 260
HgaI GACGC 1 cut(s) 183
Hin1II CATG 4 cut(s) 80, 122, 154, 279
HphI GGTGA 2 cut(s) 103, 176
Hpy166II GTNNAC 2 cut(s) 124, 268
Hpy188I TCNGA 3 cut(s) 55, 91, 228
Hpy8I GTNNAC 2 cut(s) 124, 268
Hpy99I CGWCG 1 cut(s) 177
HpyCH4V TGCA 1 cut(s) 283
HpyF10VI GCNNNNNNNGC 3 cut(s) 146, 221, 257
HpyF3I CTNAG 4 cut(s) 52, 60, 88, 262
Hsp92II CATG 4 cut(s) 80, 122, 154, 279
LmnI GCTCC 1 cut(s) 28
LpnPI CCDG 6 cut(s) 100, 127, 227, 272, 284, 299
Lsp1109I GCAGC 6 cut(s) 127, 130, 133, 235, 246, 267
MaeIII GTNAC 1 cut(s) 182
MboII GAAGA 5 cut(s) 76, 92, 96, 161, 294
MnlI CCTC 2 cut(s) 271, 283
MseI TTAA 1 cut(s) 310
MspR9I CCNGG 2 cut(s) 115, 287
Mva1269I GAATGC 1 cut(s) 177
MvaI CCWGG 2 cut(s) 115, 287
MwoI GCNNNNNNNGC 3 cut(s) 146, 221, 257
NcoI CCATGG 1 cut(s) 150
NlaIII CATG 4 cut(s) 80, 122, 154, 279
NmuCI GTSAC 1 cut(s) 182
NspI RCATGY 1 cut(s) 122
PcsI WCGNNNNNNNCGW 1 cut(s) 178
PctI GAATGC 1 cut(s) 177
PkrI GCNGC 6 cut(s) 142, 145, 148, 236, 250, 282
Psp6I CCWGG 2 cut(s) 113, 285
PspGI CCWGG 2 cut(s) 113, 285
PspPI GGNCC 1 cut(s) 268
PstNI CAGNNNCTG 1 cut(s) 59
SaqAI TTAA 1 cut(s) 310
SatI GCNGC 6 cut(s) 141, 144, 147, 235, 249, 281
Sau96I GGNCC 1 cut(s) 268
ScrFI CCNGG 2 cut(s) 115, 287
SetI ASST 6 cut(s) 25, 61, 207, 226, 239, 250
SinI GGWCC 1 cut(s) 268
SmlI CTYRAG 1 cut(s) 196
SmoI CTYRAG 1 cut(s) 196
StyD4I CCNGG 2 cut(s) 113, 285
StyI CCWWGG 1 cut(s) 150
TaqI TCGA 1 cut(s) 172
Tru1I TTAA 1 cut(s) 310
Tru9I TTAA 1 cut(s) 310
TscAI CASTG 1 cut(s) 270
TseFI GTSAC 1 cut(s) 182
TseI GCWGC 6 cut(s) 140, 143, 146, 234, 248, 280
Tsp45I GTSAC 1 cut(s) 182
TspDTI ATGAA 1 cut(s) 93
TspRI CASTG 1 cut(s) 270
VpaK11BI GGWCC 1 cut(s) 268
XceI RCATGY 1 cut(s) 122
XmiI GTMKAC 1 cut(s) 123
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.