Prupe.7G215200_v2.0.a1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp07
OG0022496
Physical Location & Seq
Reverse (-)
19490648 .. 19491376
729 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.7G215200.1

Sequence Viewer

Length: 507 bp
ATGGAGAGTTTAGAGTTGAAGTTTGACAGCACATGTGGTTGTTGGGTGTTGGAGCCCATTGAAGGCTTCAAACCAAGACCCTCAAATCCAACCTCTACCAACAGGCCCTCCACTGATACTTTGCCATCATCAATACCTTCACCAACTAGCAATTCTGCACCACCATTGCAACCACTTCCAAGAAGTGGCTTGTCTTCTCCCACTTACTTCAATCTCCGTGATTTACAAAAGCCTAGTCAAGGAAGGTTTCGCAAGATTGTGATTCGGTTTTGGAAATGTATCAAGCCAAGAATTCAATCAAGTCCTGCAAAAAAAGCGAAACAAGGAACGAAGCCTGGTGGTGCCTCAACCAAGACAAGAAGCAGTGTGCAGTCACCACAGGCACATCATGCTGAGTATTATTCTACAATGAGCCCCGATGAGCGCGATGAAAATCTAAAGGCGATCATCATCTACTGCAGGAAGTCTAATTCTACAGACTCTACAGAAGTGATGGCAGAAAACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

169

Amino Acids

18.64

Weight (kDa)

9.59

Isoelectric Point (pI)

65.84

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0022496)

Species Orthologous Gene IDs
prunus_persica Prupe.7G215200_v2.0.a1
rosa_laevigata RLG00000016316
rosa_samantha Rh2BG073300 Rh2CG074600

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 341
AccB7I CCANNNNNTGG 1 cut(s) 185
AccII CGCG 1 cut(s) 426
AcsI RAATTY 1 cut(s) 291
AfiI CCNNNNNNNGG 3 cut(s) 62, 185, 239
AflIII ACRYGT 1 cut(s) 32
AgsI TTSAA 5 cut(s) 19, 62, 70, 211, 296
AjnI CCWGG 1 cut(s) 334
AjuI GAANNNNNNNTTGG 2 cut(s) 136, 168
AoxI GGCC 1 cut(s) 104
ApoI RAATTY 1 cut(s) 291
ArsI GACNNNNNNTTYG 2 cut(s) 220, 252
AspLEI GCGC 1 cut(s) 426
AspS9I GGNCC 1 cut(s) 105
AsuHPI GGTGA 2 cut(s) 132, 366
BanI GGYRCC 1 cut(s) 341
BanII GRGCYC 2 cut(s) 57, 416
BbsI GAAGAC 1 cut(s) 186
BccI CCATC 2 cut(s) 133, 487
BciT130I CCWGG 1 cut(s) 336
BfaI CTAG 2 cut(s) 147, 234
BfmI CTRYAG 3 cut(s) 457, 474, 483
Bme1390I CCNGG 1 cut(s) 336
BmgT120I GGNCC 1 cut(s) 105
BmiI GGNNCC 2 cut(s) 54, 343
BmrFI CCNGG 1 cut(s) 336
BpiI GAAGAC 1 cut(s) 186
BsaBI GATNNNNATC 2 cut(s) 432, 449
BsaXI ACNNNNNCTCC 2 cut(s) 92, 122
Bsc4I CCNNNNNNNGG 3 cut(s) 62, 185, 239
Bse3DI GCAATG 1 cut(s) 164
Bse8I GATNNNNATC 2 cut(s) 432, 449
BseBI CCWGG 1 cut(s) 336
BseJI GATNNNNATC 2 cut(s) 432, 449
BseLI CCNNNNNNNGG 3 cut(s) 62, 185, 239
BseMI GCAATG 1 cut(s) 164
BseMII CTCAG 1 cut(s) 384
BsgI GTGCAG 2 cut(s) 141, 389
Bsh1236I CGCG 1 cut(s) 426
BshFI GGCC 1 cut(s) 106
BshNI GGYRCC 1 cut(s) 341
BslI CCNNNNNNNGG 3 cut(s) 62, 185, 239
BsnI GGCC 1 cut(s) 106
Bsp1286I GDGCHC 2 cut(s) 57, 416
Bsp143I GATC 1 cut(s) 444
BspANI GGCC 1 cut(s) 106
BspCNI CTCAG 1 cut(s) 385
BspFNI CGCG 1 cut(s) 426
BspLI GGNNCC 2 cut(s) 54, 343
BspMAI CTGCAG 1 cut(s) 461
BspT107I GGYRCC 1 cut(s) 341
BsrDI GCAATG 1 cut(s) 164
BssMI GATC 1 cut(s) 444
Bst2UI CCWGG 1 cut(s) 336
BstAPI GCANNNNNTGC 1 cut(s) 389
BstDEI CTNAG 1 cut(s) 393
BstENI CCTNNNNNAGG 1 cut(s) 237
BstFNI CGCG 1 cut(s) 426
BstHHI GCGC 1 cut(s) 426
BstKTI GATC 1 cut(s) 447
BstMBI GATC 1 cut(s) 444
BstMWI GCNNNNNNNGC 2 cut(s) 314, 389
BstNI CCWGG 1 cut(s) 336
BstNSI RCATGY 1 cut(s) 36
BstSCI CCNGG 1 cut(s) 334
BstSFI CTRYAG 3 cut(s) 457, 474, 483
BstUI CGCG 1 cut(s) 426
BstV2I GAAGAC 1 cut(s) 186
BsuRI GGCC 1 cut(s) 106
BtgZI GCGATG 1 cut(s) 441
BtsI GCAGTG 1 cut(s) 370
BtsIMutI CAGTG 2 cut(s) 111, 370
CfoI GCGC 1 cut(s) 426
Cfr13I GGNCC 1 cut(s) 105
CviAII CATG 2 cut(s) 33, 389
CviJI RGCY 8 cut(s) 55, 66, 106, 189, 232, 286, 334, 414
CviKI_1 RGCY 8 cut(s) 55, 66, 106, 189, 232, 286, 334, 414
DdeI CTNAG 1 cut(s) 393
DpnI GATC 1 cut(s) 446
DpnII GATC 1 cut(s) 444
Eco24I GRGCYC 2 cut(s) 57, 416
EcoNI CCTNNNNNAGG 1 cut(s) 237
EcoO109I RGGNCCY 1 cut(s) 105
EcoRI GAATTC 1 cut(s) 291
EcoRII CCWGG 1 cut(s) 334
EcoT38I GRGCYC 2 cut(s) 57, 416
FaeI CATG 2 cut(s) 36, 392
FaiI YATR 2 cut(s) 34, 390
FatI CATG 2 cut(s) 32, 388
FriOI GRGCYC 2 cut(s) 57, 416
FspBI CTAG 2 cut(s) 147, 234
GlaI GCGC 1 cut(s) 425
HaeIII GGCC 1 cut(s) 106
HhaI GCGC 1 cut(s) 426
Hin1II CATG 2 cut(s) 36, 392
Hin6I GCGC 1 cut(s) 424
HinP1I GCGC 1 cut(s) 424
HinfI GANTC 2 cut(s) 262, 479
HphI GGTGA 2 cut(s) 132, 366
HpyAV CCTTC 3 cut(s) 56, 147, 237
HpyCH4V TGCA 5 cut(s) 158, 169, 308, 370, 459
HpyF10VI GCNNNNNNNGC 2 cut(s) 314, 389
HpyF3I CTNAG 1 cut(s) 393
Hsp92II CATG 2 cut(s) 36, 392
HspAI GCGC 1 cut(s) 424
Kzo9I GATC 1 cut(s) 444
LmnI GCTCC 1 cut(s) 52
LpnPI CCDG 6 cut(s) 88, 318, 321, 348, 365, 445
MaeI CTAG 2 cut(s) 147, 234
MaeIII GTNAC 1 cut(s) 372
MalI GATC 1 cut(s) 446
MboI GATC 1 cut(s) 444
MboII GAAGA 1 cut(s) 186
MhlI GDGCHC 2 cut(s) 57, 416
MluCI AATT 3 cut(s) 151, 291, 469
MlyI GAGTC 1 cut(s) 473
MmeI TCCRAC 2 cut(s) 30, 113
MnlI CCTC 4 cut(s) 91, 103, 118, 355
MspR9I CCNGG 1 cut(s) 336
MvaI CCWGG 1 cut(s) 336
MvnI CGCG 1 cut(s) 426
MwoI GCNNNNNNNGC 2 cut(s) 314, 389
NdeII GATC 1 cut(s) 444
NlaIII CATG 2 cut(s) 36, 392
NlaIV GGNNCC 2 cut(s) 54, 343
NmuCI GTSAC 1 cut(s) 372
NspI RCATGY 1 cut(s) 36
PciI ACATGT 1 cut(s) 32
PfeI GAWTC 1 cut(s) 262
PflMI CCANNNNNTGG 1 cut(s) 185
PleI GAGTC 1 cut(s) 473
PpsI GAGTC 1 cut(s) 473
PscI ACATGT 1 cut(s) 32
Psp6I CCWGG 1 cut(s) 334
PspGI CCWGG 1 cut(s) 334
PspN4I GGNNCC 2 cut(s) 54, 343
PspPI GGNCC 1 cut(s) 105
PstI CTGCAG 1 cut(s) 461
Sau3AI GATC 1 cut(s) 444
Sau96I GGNCC 1 cut(s) 105
SchI GAGTC 1 cut(s) 473
ScrFI CCNGG 1 cut(s) 336
SduI GDGCHC 2 cut(s) 57, 416
SetI ASST 3 cut(s) 95, 139, 248
SfcI CTRYAG 3 cut(s) 457, 474, 483
Sse9I AATT 3 cut(s) 151, 291, 469
SspMI CTAG 2 cut(s) 147, 234
StyD4I CCNGG 1 cut(s) 334
TasI AATT 3 cut(s) 151, 291, 469
TfiI GAWTC 1 cut(s) 262
TscAI CASTG 2 cut(s) 118, 370
TseFI GTSAC 1 cut(s) 372
Tsp45I GTSAC 1 cut(s) 372
TspDTI ATGAA 1 cut(s) 444
TspGWI ACGGA 1 cut(s) 206
TspRI CASTG 2 cut(s) 118, 370
Van91I CCANNNNNTGG 1 cut(s) 185
XagI CCTNNNNNAGG 1 cut(s) 237
XapI RAATTY 1 cut(s) 291
XceI RCATGY 1 cut(s) 36
XspI CTAG 2 cut(s) 147, 234
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.