pycom02g26910

Plant non-specific lipid-transfer proteins transfer phospholipids as well as galactolipids across membranes. May play a role in wax or cutin deposition in the cell walls of expanding epidermal cells and certain secretory tissues

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr2
OG0022021
Physical Location & Seq
Reverse (-)
24740462 .. 24741269
808 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 465 bp
ATGAGGGGCCATATATTAAAGTTTTCAGAAACTTTGCGAGTGAACAAAGACTGCAGGGCAAACGCAAGATACGTAGCTAATCTTTATCTCTCTAAATCTAAAACCATGAAACTTTCTAGTGTGAGTGTGGCTACTGCTGCTCTTATGCTACTTCTTCTTCTTTTACTGGCTGCAAGTTCGGAGGCCACAATAACATGCAGTGACGTAACCAAGGACCTTAGACCATGCCTAAGCTACCTTGTAAGTGGCTCAGGGAAGCCACCTGCTGCATGTTGTGCTGGAGCCTCAGCCCTCGCATCTGCTGCGTCAACCTCTGCTGATAAGAAGGCTGTATGTGCCTGTGTTAAATCGGCAGCCCAGAAAATTAATATCAAATACCAGTTGGCCCAAGCTCTCCCTGGGAACTGTGGGATCAACTTGTCCTTCTCTATTTCTCCAAATACCGACTGTTCAAAGATTGGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0005575 GO:0006810 GO:0006869 GO:0008150 GO:0010876 GO:0016020 GO:0033036 GO:0051179 GO:0051234 GO:0071702
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Tryp_alpha_amyl

Protein Analysis

155

Amino Acids

15.96

Weight (kDa)

9.41

Isoelectric Point (pI)

30.21

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Tryp_alpha_amyl PF00234 66 - 150 1.8e-11 Protease inhibitor/seed storage/LTP family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0022021)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G18370
malus_domestica MD00G1187200.v1.1
prunus_persica Prupe.2G000900_v2.0.a1
pyrus_communis pycom02g26910

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 271
Acc36I ACCTGC 1 cut(s) 271
AclWI GGATC 1 cut(s) 419
AgsI TTSAA 1 cut(s) 453
AjnI CCWGG 1 cut(s) 397
AluBI AGCT 3 cut(s) 77, 234, 392
AluI AGCT 3 cut(s) 77, 234, 392
AlwI GGATC 1 cut(s) 419
AoxI GGCC 3 cut(s) 7, 183, 384
ApeKI GCWGC 5 cut(s) 137, 170, 266, 302, 353
AseI ATTAAT 1 cut(s) 366
AspS9I GGNCC 3 cut(s) 7, 214, 385
AvaII GGWCC 1 cut(s) 214
BbvCI CCTCAGC 1 cut(s) 286
BbvI GCAGC 5 cut(s) 124, 157, 253, 289, 365
BciT130I CCWGG 1 cut(s) 399
BfaI CTAG 1 cut(s) 117
BfmI CTRYAG 1 cut(s) 52
BfuAI ACCTGC 1 cut(s) 271
BisI GCNGC 5 cut(s) 138, 171, 267, 303, 354
BlsI GCNGC 5 cut(s) 139, 172, 268, 304, 355
Bme1390I CCNGG 1 cut(s) 399
Bme18I GGWCC 1 cut(s) 214
BmgT120I GGNCC 3 cut(s) 7, 214, 385
BmiI GGNNCC 2 cut(s) 8, 283
BmrFI CCNGG 1 cut(s) 399
BmsI GCATC 1 cut(s) 305
BpmI CTGGAG 1 cut(s) 300
Bpu10I CCTNAGC 3 cut(s) 230, 250, 286
BsaAI YACGTR 1 cut(s) 73
BsaJI CCNNGG 3 cut(s) 210, 397, 398
Bse1I ACTGG 2 cut(s) 171, 379
BseBI CCWGG 1 cut(s) 399
BseDI CCNNGG 3 cut(s) 210, 397, 398
BseMII CTCAG 2 cut(s) 264, 300
BseNI ACTGG 2 cut(s) 171, 379
BseXI GCAGC 5 cut(s) 124, 157, 253, 289, 365
BshFI GGCC 3 cut(s) 9, 185, 386
BsnI GGCC 3 cut(s) 9, 185, 386
Bsp143I GATC 1 cut(s) 411
BspANI GGCC 3 cut(s) 9, 185, 386
BspCNI CTCAG 2 cut(s) 263, 299
BspLI GGNNCC 2 cut(s) 8, 283
BspMAI CTGCAG 1 cut(s) 56
BspMI ACCTGC 1 cut(s) 271
BspPI GGATC 1 cut(s) 419
BsrI ACTGG 2 cut(s) 171, 379
BssECI CCNNGG 3 cut(s) 210, 397, 398
BssMI GATC 1 cut(s) 411
BssT1I CCWWGG 1 cut(s) 210
Bst2UI CCWGG 1 cut(s) 399
Bst4CI ACNGT 2 cut(s) 407, 449
BstAPI GCANNNNNTGC 2 cut(s) 275, 302
BstBAI YACGTR 1 cut(s) 73
BstDEI CTNAG 4 cut(s) 218, 230, 250, 286
BstKTI GATC 1 cut(s) 414
BstMBI GATC 1 cut(s) 411
BstMWI GCNNNNNNNGC 4 cut(s) 137, 275, 302, 335
BstNI CCWGG 1 cut(s) 399
BstNSI RCATGY 2 cut(s) 198, 273
BstSCI CCNGG 1 cut(s) 397
BstSFI CTRYAG 1 cut(s) 52
BstSNI TACGTA 1 cut(s) 73
BstV1I GCAGC 5 cut(s) 124, 157, 253, 289, 365
BsuRI GGCC 3 cut(s) 9, 185, 386
BtsI GCAGTG 1 cut(s) 205
BtsIMutI CAGTG 1 cut(s) 205
BveI ACCTGC 1 cut(s) 271
Cfr13I GGNCC 3 cut(s) 7, 214, 385
CseI GACGC 1 cut(s) 294
CviAII CATG 4 cut(s) 106, 195, 225, 270
DdeI CTNAG 4 cut(s) 218, 230, 250, 286
DpnI GATC 1 cut(s) 413
DpnII GATC 1 cut(s) 411
Eco105I TACGTA 1 cut(s) 73
Eco130I CCWWGG 1 cut(s) 210
Eco47I GGWCC 1 cut(s) 214
EcoO109I RGGNCCY 1 cut(s) 214
EcoRII CCWGG 1 cut(s) 397
EcoT14I CCWWGG 1 cut(s) 210
ErhI CCWWGG 1 cut(s) 210
FaeI CATG 4 cut(s) 109, 198, 228, 273
FaiI YATR 8 cut(s) 12, 14, 107, 146, 196, 226, 271, 334
FatI CATG 4 cut(s) 105, 194, 224, 269
Fnu4HI GCNGC 5 cut(s) 138, 171, 267, 303, 354
Fsp4HI GCNGC 5 cut(s) 138, 171, 267, 303, 354
FspBI CTAG 1 cut(s) 117
GluI GCNGC 5 cut(s) 138, 171, 267, 303, 354
GsuI CTGGAG 1 cut(s) 300
HaeIII GGCC 3 cut(s) 9, 185, 386
HgaI GACGC 1 cut(s) 294
Hin1II CATG 4 cut(s) 109, 198, 228, 273
HincII GTYRAC 1 cut(s) 309
HindII GTYRAC 1 cut(s) 309
Hpy166II GTNNAC 2 cut(s) 43, 309
Hpy188I TCNGA 2 cut(s) 28, 181
Hpy8I GTNNAC 2 cut(s) 43, 309
HpyAV CCTTC 2 cut(s) 319, 433
HpyCH4III ACNGT 2 cut(s) 407, 449
HpyCH4IV ACGT 2 cut(s) 72, 204
HpyCH4V TGCA 4 cut(s) 54, 173, 198, 269
HpyF10VI GCNNNNNNNGC 4 cut(s) 137, 275, 302, 335
HpyF3I CTNAG 4 cut(s) 218, 230, 250, 286
HpySE526I ACGT 2 cut(s) 72, 204
Hsp92II CATG 4 cut(s) 109, 198, 228, 273
Kzo9I GATC 1 cut(s) 411
LmnI GCTCC 1 cut(s) 281
Lsp1109I GCAGC 5 cut(s) 124, 157, 253, 289, 365
LweI GCATC 1 cut(s) 305
MaeI CTAG 1 cut(s) 117
MaeII ACGT 2 cut(s) 72, 204
MaeIII GTNAC 2 cut(s) 200, 205
MalI GATC 1 cut(s) 413
MboI GATC 1 cut(s) 411
MboII GAAGA 2 cut(s) 146, 149
MluCI AATT 1 cut(s) 363
MnlI CCTC 4 cut(s) 175, 295, 302, 322
MseI TTAA 3 cut(s) 17, 345, 366
MspR9I CCNGG 1 cut(s) 399
MvaI CCWGG 1 cut(s) 399
MwoI GCNNNNNNNGC 4 cut(s) 137, 275, 302, 335
NdeII GATC 1 cut(s) 411
NlaIII CATG 4 cut(s) 109, 198, 228, 273
NlaIV GGNNCC 2 cut(s) 8, 283
NmuCI GTSAC 1 cut(s) 200
NspI RCATGY 2 cut(s) 198, 273
PaqCI CACCTGC 1 cut(s) 271
PasI CCCWGGG 1 cut(s) 398
PcsI WCGNNNNNNNCGW 1 cut(s) 69
PkrI GCNGC 5 cut(s) 139, 172, 268, 304, 355
Ppu21I YACGTR 1 cut(s) 73
PpuMI RGGWCCY 1 cut(s) 214
PshBI ATTAAT 1 cut(s) 366
Psp5II RGGWCCY 1 cut(s) 214
Psp6I CCWGG 1 cut(s) 397
PspGI CCWGG 1 cut(s) 397
PspN4I GGNNCC 2 cut(s) 8, 283
PspPI GGNCC 3 cut(s) 7, 214, 385
PspPPI RGGWCCY 1 cut(s) 214
PstI CTGCAG 1 cut(s) 56
SaqAI TTAA 3 cut(s) 17, 345, 366
SatI GCNGC 5 cut(s) 138, 171, 267, 303, 354
Sau3AI GATC 1 cut(s) 411
Sau96I GGNCC 3 cut(s) 7, 214, 385
ScrFI CCNGG 1 cut(s) 399
SetI ASST 9 cut(s) 75, 79, 207, 219, 236, 240, 265, 314, 394
SfaNI GCATC 1 cut(s) 305
SfcI CTRYAG 1 cut(s) 52
SinI GGWCC 1 cut(s) 214
SnaBI TACGTA 1 cut(s) 73
Sse9I AATT 1 cut(s) 363
SspMI CTAG 1 cut(s) 117
StyD4I CCNGG 1 cut(s) 397
StyI CCWWGG 1 cut(s) 210
TaaI ACNGT 2 cut(s) 407, 449
TaiI ACGT 2 cut(s) 75, 207
TasI AATT 1 cut(s) 363
Tru1I TTAA 3 cut(s) 17, 345, 366
Tru9I TTAA 3 cut(s) 17, 345, 366
TscAI CASTG 1 cut(s) 205
TseFI GTSAC 1 cut(s) 200
TseI GCWGC 5 cut(s) 137, 170, 266, 302, 353
Tsp45I GTSAC 1 cut(s) 200
TspDTI ATGAA 1 cut(s) 122
TspRI CASTG 1 cut(s) 205
VpaK11BI GGWCC 1 cut(s) 214
VspI ATTAAT 1 cut(s) 366
XceI RCATGY 2 cut(s) 198, 273
XcmI CCANNNNNNNNNTGG 1 cut(s) 395
XspI CTAG 1 cut(s) 117
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.