pycom05g10150

Peter Pan-like protein

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr5
Physical Location & Seq
Forward (+)
13521349 .. 13521841
493 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom05g10150.1

Sequence Viewer

Length: 231 bp
ATGGCTGGCTTAAAAAATAAGAAGAACATGTGTGTGAAGTCGGTTTCGACGAAGAAGCAGGCTAATATGGACCATATCACAAGGGATAAAATCCCAAGGAGGTTTTTGTTTTCCAGATGCAAGTTGCTTGGTCCTCTGAAGCAGCTTCAAGCTGATTTGAGAAACTGGTGCTTCCCTACACTGCCTTTAAGCTTAAGGAGAAGAGGCAGAACAATCTTAGAGACTTTTTGA

Protein Analysis

77

Amino Acids

8.92

Weight (kDa)

11.29

Isoelectric Point (pI)

60.04

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0022389)

Species Orthologous Gene IDs
malus_domestica MD08G1232400.v1.1
pyrus_communis pycom04g01110 pycom05g10150 pycom10g00690

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 158
AflII CTTAAG 1 cut(s) 193
AflIII ACRYGT 1 cut(s) 27
AgsI TTSAA 1 cut(s) 149
AluBI AGCT 3 cut(s) 145, 152, 192
AluI AGCT 3 cut(s) 145, 152, 192
Alw26I GTCTC 1 cut(s) 215
ApeKI GCWGC 1 cut(s) 142
AspS9I GGNCC 2 cut(s) 70, 131
AvaII GGWCC 2 cut(s) 70, 131
BbvI GCAGC 1 cut(s) 154
BcoDI GTCTC 1 cut(s) 215
BfrI CTTAAG 1 cut(s) 193
BisI GCNGC 1 cut(s) 143
BlsI GCNGC 1 cut(s) 144
Bme18I GGWCC 2 cut(s) 70, 131
BmgT120I GGNCC 2 cut(s) 70, 131
BmsI GCATC 1 cut(s) 107
BsaJI CCNNGG 1 cut(s) 95
Bse1I ACTGG 1 cut(s) 170
BseDI CCNNGG 1 cut(s) 95
BseNI ACTGG 1 cut(s) 170
BseXI GCAGC 1 cut(s) 154
BsmAI GTCTC 1 cut(s) 215
BspTI CTTAAG 1 cut(s) 193
BsrI ACTGG 1 cut(s) 170
BssECI CCNNGG 1 cut(s) 95
BssT1I CCWWGG 1 cut(s) 95
Bst6I CTCTTC 1 cut(s) 196
BstAFI CTTAAG 1 cut(s) 193
BstC8I GCNNGC 2 cut(s) 7, 60
BstDEI CTNAG 1 cut(s) 217
BstMAI GTCTC 1 cut(s) 215
BstNSI RCATGY 1 cut(s) 31
BstV1I GCAGC 1 cut(s) 154
BtsI GCAGTG 1 cut(s) 179
BtsIMutI CAGTG 1 cut(s) 179
Cac8I GCNNGC 2 cut(s) 7, 60
Cfr13I GGNCC 2 cut(s) 70, 131
CviAII CATG 1 cut(s) 28
CviJI RGCY 6 cut(s) 5, 9, 62, 145, 152, 192
CviKI_1 RGCY 6 cut(s) 5, 9, 62, 145, 152, 192
DdeI CTNAG 1 cut(s) 217
Eam1104I CTCTTC 1 cut(s) 196
EarI CTCTTC 1 cut(s) 196
Eco130I CCWWGG 1 cut(s) 95
Eco47I GGWCC 2 cut(s) 70, 131
Eco57I CTGAAG 1 cut(s) 158
EcoT14I CCWWGG 1 cut(s) 95
ErhI CCWWGG 1 cut(s) 95
FaeI CATG 1 cut(s) 31
FaiI YATR 3 cut(s) 29, 68, 75
FatI CATG 1 cut(s) 27
Fnu4HI GCNGC 1 cut(s) 143
Fsp4HI GCNGC 1 cut(s) 143
GluI GCNGC 1 cut(s) 143
Hin1II CATG 1 cut(s) 31
HindIII AAGCTT 1 cut(s) 190
Hpy188I TCNGA 1 cut(s) 138
Hpy188III TCNNGA 1 cut(s) 114
Hpy99I CGWCG 1 cut(s) 52
HpyCH4V TGCA 1 cut(s) 120
HpyF3I CTNAG 1 cut(s) 217
Hsp92II CATG 1 cut(s) 31
LpnPI CCDG 3 cut(s) 44, 127, 151
Lsp1109I GCAGC 1 cut(s) 154
LweI GCATC 1 cut(s) 107
MboII GAAGA 3 cut(s) 34, 64, 213
MnlI CCTC 3 cut(s) 93, 144, 197
MseI TTAA 3 cut(s) 11, 188, 194
MslI CAYNNNNRTG 1 cut(s) 32
MspCI CTTAAG 1 cut(s) 193
NlaIII CATG 1 cut(s) 31
NspI RCATGY 1 cut(s) 31
PciI ACATGT 1 cut(s) 27
PcsI WCGNNNNNNNCGW 1 cut(s) 47
PkrI GCNGC 1 cut(s) 144
PscI ACATGT 1 cut(s) 27
PspPI GGNCC 2 cut(s) 70, 131
RseI CAYNNNNRTG 1 cut(s) 32
SaqAI TTAA 3 cut(s) 11, 188, 194
SatI GCNGC 1 cut(s) 143
Sau96I GGNCC 2 cut(s) 70, 131
SetI ASST 4 cut(s) 104, 147, 154, 194
SfaNI GCATC 1 cut(s) 107
SinI GGWCC 2 cut(s) 70, 131
SmiMI CAYNNNNRTG 1 cut(s) 32
SmlI CTYRAG 1 cut(s) 193
SmoI CTYRAG 1 cut(s) 193
StyI CCWWGG 1 cut(s) 95
TaqI TCGA 1 cut(s) 47
Tru1I TTAA 3 cut(s) 11, 188, 194
Tru9I TTAA 3 cut(s) 11, 188, 194
TscAI CASTG 1 cut(s) 186
TseI GCWGC 1 cut(s) 142
TspRI CASTG 1 cut(s) 186
Vha464I CTTAAG 1 cut(s) 193
VpaK11BI GGWCC 2 cut(s) 70, 131
XceI RCATGY 1 cut(s) 31
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.