pycom05g17800

LRR receptor-like serine threonine-protein kinase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr5
OG0021263
Physical Location & Seq
Forward (+)
20947237 .. 20947623
387 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom05g17800.1

Sequence Viewer

Length: 387 bp
ATGATAATATACAGCAGCAGCATCAGAGAATCTTCTAGTTCCCTTTATATTTTTCAATTTTTGTTGTCCCTTTACCTTTGTCGAATGAATGCGAAATATTTGAAGCAGCATAAACTCTCTGATGTATTTACCAGTCCAATCTTGCCTTCAGTGATCTCCAATTGGAGTCTACTTGTCCATTTGAATCTTCGACGCAATAGCTTCAGTGGGAATATTCCACCTGAGCTTGGGCAGTTGACAGATTTGAATTATCTAAGCCTAGACTCTAATTATTTTGGTGGGGGACTTCCTACTCAAATTGGAAATCTAAACTTGCTATACACACTAAACGTGAGCAGGAACAATTTGACAAGAGTGATCCTTCAGAGTATCGGCAATTTCACTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
LRRNT_2 LRR_1 LRR_4 LRR_8 Pkinase Pkinase_Tyr

Protein Analysis

129

Amino Acids

14.48

Weight (kDa)

9.46

Isoelectric Point (pI)

51.36

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
LRR_14 PF23598 52 - 118 1.7e-06 Leucine-rich repeat region
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0021263)

Species Orthologous Gene IDs
pyrus_communis pycom05g17650 pycom05g17700 pycom05g17800
rosa_chinensis RchiOBHm_Chr6g0287021
rosa_roxburghii Rroxscaffold_7G00181730

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 169
AclWI GGATC 1 cut(s) 352
AcuI CTGAAG 3 cut(s) 132, 187, 347
AfiI CCNNNNNNNGG 1 cut(s) 227
AgsI TTSAA 4 cut(s) 56, 103, 184, 247
AjuI GAANNNNNNNTTGG 2 cut(s) 130, 162
AluBI AGCT 2 cut(s) 201, 226
AluI AGCT 2 cut(s) 201, 226
AlwI GGATC 1 cut(s) 352
ApeKI GCWGC 3 cut(s) 15, 18, 106
BbvI GCAGC 3 cut(s) 27, 30, 118
BfaI CTAG 2 cut(s) 36, 260
BisI GCNGC 3 cut(s) 16, 19, 107
BlsI GCNGC 3 cut(s) 17, 20, 108
BmsI GCATC 1 cut(s) 30
Bpu10I CCTNAGC 1 cut(s) 222
Bsc4I CCNNNNNNNGG 1 cut(s) 227
Bse1I ACTGG 1 cut(s) 132
BseLI CCNNNNNNNGG 1 cut(s) 227
BseMII CTCAG 1 cut(s) 213
BseNI ACTGG 1 cut(s) 132
BseXI GCAGC 3 cut(s) 27, 30, 118
BslFI GGGAC 2 cut(s) 52, 297
BslI CCNNNNNNNGG 1 cut(s) 227
BsmFI GGGAC 2 cut(s) 52, 297
BsmI GAATGC 1 cut(s) 94
Bsp143I GATC 2 cut(s) 153, 357
BspCNI CTCAG 1 cut(s) 214
BspPI GGATC 1 cut(s) 352
BsrI ACTGG 1 cut(s) 132
BssMI GATC 2 cut(s) 153, 357
BstDEI CTNAG 3 cut(s) 222, 254, 384
BstKTI GATC 2 cut(s) 156, 360
BstMBI GATC 2 cut(s) 153, 357
BstV1I GCAGC 3 cut(s) 27, 30, 118
BtsIMutI CAGTG 2 cut(s) 156, 211
CseI GACGC 1 cut(s) 201
CviJI RGCY 3 cut(s) 201, 226, 258
CviKI_1 RGCY 3 cut(s) 201, 226, 258
DdeI CTNAG 3 cut(s) 222, 254, 384
DpnI GATC 2 cut(s) 155, 359
DpnII GATC 2 cut(s) 153, 357
Eco57I CTGAAG 3 cut(s) 132, 187, 347
FaiI YATR 4 cut(s) 10, 48, 111, 319
FaqI GGGAC 2 cut(s) 52, 297
FblI GTMKAC 1 cut(s) 169
Fnu4HI GCNGC 3 cut(s) 16, 19, 107
Fsp4HI GCNGC 3 cut(s) 16, 19, 107
FspBI CTAG 2 cut(s) 36, 260
GluI GCNGC 3 cut(s) 16, 19, 107
HgaI GACGC 1 cut(s) 201
HincII GTYRAC 1 cut(s) 237
HindII GTYRAC 1 cut(s) 237
HinfI GANTC 4 cut(s) 29, 166, 184, 263
Hpy166II GTNNAC 2 cut(s) 170, 237
Hpy188I TCNGA 3 cut(s) 26, 121, 366
Hpy8I GTNNAC 2 cut(s) 170, 237
Hpy99I CGWCG 1 cut(s) 195
HpyAV CCTTC 2 cut(s) 156, 371
HpyCH4IV ACGT 1 cut(s) 330
HpyF3I CTNAG 3 cut(s) 222, 254, 384
HpySE526I ACGT 1 cut(s) 330
Kzo9I GATC 2 cut(s) 153, 357
LpnPI CCDG 3 cut(s) 145, 234, 322
Lsp1109I GCAGC 3 cut(s) 27, 30, 118
LweI GCATC 1 cut(s) 30
MaeI CTAG 2 cut(s) 36, 260
MaeII ACGT 1 cut(s) 330
MalI GATC 2 cut(s) 155, 359
MboI GATC 2 cut(s) 153, 357
MboII GAAGA 2 cut(s) 24, 179
MfeI CAATTG 1 cut(s) 160
MluCI AATT 7 cut(s) 56, 160, 247, 268, 297, 343, 376
MlyI GAGTC 2 cut(s) 175, 257
MunI CAATTG 1 cut(s) 160
Mva1269I GAATGC 1 cut(s) 94
NdeII GATC 2 cut(s) 153, 357
PctI GAATGC 1 cut(s) 94
PfeI GAWTC 2 cut(s) 29, 184
PkrI GCNGC 3 cut(s) 17, 20, 108
PleI GAGTC 2 cut(s) 174, 257
PpsI GAGTC 2 cut(s) 174, 257
SatI GCNGC 3 cut(s) 16, 19, 107
Sau3AI GATC 2 cut(s) 153, 357
SchI GAGTC 2 cut(s) 175, 257
SetI ASST 5 cut(s) 78, 203, 223, 228, 333
SfaNI GCATC 1 cut(s) 30
Sse9I AATT 7 cut(s) 56, 160, 247, 268, 297, 343, 376
SspI AATATT 2 cut(s) 98, 214
SspMI CTAG 2 cut(s) 36, 260
TaiI ACGT 1 cut(s) 333
TaqI TCGA 2 cut(s) 82, 190
TasI AATT 7 cut(s) 56, 160, 247, 268, 297, 343, 376
TfiI GAWTC 2 cut(s) 29, 184
TscAI CASTG 2 cut(s) 156, 211
TseI GCWGC 3 cut(s) 15, 18, 106
TspDTI ATGAA 1 cut(s) 101
TspRI CASTG 2 cut(s) 156, 211
XmiI GTMKAC 1 cut(s) 169
XspI CTAG 2 cut(s) 36, 260
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.