pycom05g26900

Belongs to the iron ascorbate-dependent oxidoreductase family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr5
OG0021265
Physical Location & Seq
Forward (+)
28030910 .. 28031146
237 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom05g26900.1

Sequence Viewer

Length: 237 bp
ATGCTGAGCAACGGAGTTTACAAACGCATTGAACACAGGGCAATGGTGAATTCAGAGAAAGAAAGGGTGTCGGTTGCGATGTTCTTCAACCCTAAATTTGAGGCAGAGATTGGGCCACTCAGAAGCTTGATAACCCCAGAAAACCCACCACTGTTCCAAAGGTTGGGATGGAAAAGTACGTCAACGAGTTCTTCTCCCGCCGCAGGCTTGACGGAAAATCGTACTTGGAGCAAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
2OG-FeII_Oxy DIOX_N

Protein Analysis

79

Amino Acids

8.81

Weight (kDa)

9.98

Isoelectric Point (pI)

47.99

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
2OG-FeII_Oxy PF03171 2 - 31 7.7e-06 2OG-Fe(II) oxygenase superfamily
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0021265)

Species Orthologous Gene IDs
pyrus_communis pycom05g26900
rosa_multiflora Rmu_sc0000059.1_g000008 Rmu_sc0038764.1_g000001
rosa_roxburghii Rroxscaffold_1G00063910
rosa_samantha Rh5BG094600

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 163
AciI CCGC 2 cut(s) 198, 201
AcsI RAATTY 2 cut(s) 49, 95
AfaI GTAC 2 cut(s) 178, 223
AfiI CCNNNNNNNGG 2 cut(s) 163, 203
AgsI TTSAA 2 cut(s) 32, 88
AluBI AGCT 1 cut(s) 126
AluI AGCT 1 cut(s) 126
AoxI GGCC 1 cut(s) 113
ApoI RAATTY 2 cut(s) 49, 95
AspS9I GGNCC 1 cut(s) 113
AsuHPI GGTGA 1 cut(s) 58
BccI CCATC 1 cut(s) 162
BisI GCNGC 1 cut(s) 201
BlpI GCTNAGC 1 cut(s) 5
BlsI GCNGC 1 cut(s) 202
BmgT120I GGNCC 1 cut(s) 113
BplI GAGNNNNNCTC 2 cut(s) 178, 210
Bpu1102I GCTNAGC 1 cut(s) 5
Bsc4I CCNNNNNNNGG 2 cut(s) 163, 203
Bse3DI GCAATG 1 cut(s) 48
BseGI GGATG 1 cut(s) 173
BseLI CCNNNNNNNGG 2 cut(s) 163, 203
BseMI GCAATG 1 cut(s) 48
BseMII CTCAG 1 cut(s) 133
BshFI GGCC 1 cut(s) 115
BslI CCNNNNNNNGG 2 cut(s) 163, 203
BsnI GGCC 1 cut(s) 115
Bsp1720I GCTNAGC 1 cut(s) 5
BspACI CCGC 2 cut(s) 198, 201
BspANI GGCC 1 cut(s) 115
BspCNI CTCAG 1 cut(s) 132
BsrDI GCAATG 1 cut(s) 48
Bst4CI ACNGT 1 cut(s) 153
BstC8I GCNNGC 1 cut(s) 205
BstDEI CTNAG 2 cut(s) 5, 119
BstF5I GGATG 1 cut(s) 173
BsuRI GGCC 1 cut(s) 115
BtgZI GCGATG 1 cut(s) 92
BtsCI GGATG 1 cut(s) 173
BtsIMutI CAGTG 1 cut(s) 149
Cac8I GCNNGC 1 cut(s) 205
Cfr13I GGNCC 1 cut(s) 113
Csp6I GTAC 2 cut(s) 177, 222
CviJI RGCY 3 cut(s) 115, 126, 207
CviKI_1 RGCY 3 cut(s) 115, 126, 207
CviQI GTAC 2 cut(s) 177, 222
DdeI CTNAG 2 cut(s) 5, 119
EcoRI GAATTC 1 cut(s) 49
FauI CCCGC 1 cut(s) 205
Fnu4HI GCNGC 1 cut(s) 201
FokI GGATG 1 cut(s) 180
Fsp4HI GCNGC 1 cut(s) 201
GluI GCNGC 1 cut(s) 201
HaeIII GGCC 1 cut(s) 115
HincII GTYRAC 1 cut(s) 183
HindII GTYRAC 1 cut(s) 183
HindIII AAGCTT 1 cut(s) 124
HphI GGTGA 1 cut(s) 58
Hpy166II GTNNAC 2 cut(s) 19, 183
Hpy188I TCNGA 2 cut(s) 55, 122
Hpy8I GTNNAC 2 cut(s) 19, 183
HpyCH4III ACNGT 1 cut(s) 153
HpyCH4IV ACGT 1 cut(s) 179
HpyF3I CTNAG 2 cut(s) 5, 119
HpySE526I ACGT 1 cut(s) 179
LmnI GCTCC 1 cut(s) 228
LpnPI CCDG 3 cut(s) 22, 150, 189
MaeII ACGT 1 cut(s) 179
MboII GAAGA 2 cut(s) 76, 183
MluCI AATT 2 cut(s) 49, 95
MnlI CCTC 1 cut(s) 94
PflMI CCANNNNNTGG 1 cut(s) 163
PkrI GCNGC 1 cut(s) 202
PspPI GGNCC 1 cut(s) 113
RsaI GTAC 2 cut(s) 178, 223
RsaNI GTAC 2 cut(s) 177, 222
SatI GCNGC 1 cut(s) 201
Sau96I GGNCC 1 cut(s) 113
SetI ASST 3 cut(s) 128, 164, 182
SgeI CNNG 7 cut(s) 49, 139, 149, 198, 209, 216, 220
Sse9I AATT 2 cut(s) 49, 95
SsiI CCGC 2 cut(s) 198, 201
TaaI ACNGT 1 cut(s) 153
TaiI ACGT 1 cut(s) 182
TasI AATT 2 cut(s) 49, 95
TauI GCSGC 1 cut(s) 203
TscAI CASTG 1 cut(s) 156
TspGWI ACGGA 2 cut(s) 27, 227
TspRI CASTG 1 cut(s) 156
Van91I CCANNNNNTGG 1 cut(s) 163
XapI RAATTY 2 cut(s) 49, 95
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.