pycom06g21010

Protein kinase domain

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr6
Physical Location & Seq
Forward (+)
23826661 .. 23827095
435 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom06g21010.2

Sequence Viewer

Length: 258 bp
ATGCTAGCGAAAGGGCGTGATACATACAAATACTTCACAAAAAATCACATGCTTTATGAACGGAATCAGGAAACTAACAGACTGGAATACCTGATACCAAAGAAGACATCCTTGAGGCACAGGCTTCCAATGGGGGACCAAAGCTTCATTGACTTCATTGCTCATCTGCTTGAGATAAACCCGAAGAAGCGCCCTTCTGCATCTGACGCTCTGAAGCACCCGTGGCTATCATATCCTTATGAACCTATATCATCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

86

Amino Acids

10.14

Weight (kDa)

9.6

Isoelectric Point (pI)

31.31

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0023734)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G03175
pyrus_communis pycom06g21010
rosa_multiflora Rmu_sc0004449.1_g000001

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 233
AluBI AGCT 1 cut(s) 144
AluI AGCT 1 cut(s) 144
AspLEI GCGC 1 cut(s) 192
AspS9I GGNCC 1 cut(s) 136
AsuNHI GCTAGC 1 cut(s) 4
AvaII GGWCC 1 cut(s) 136
BbsI GAAGAC 1 cut(s) 110
BfaI CTAG 1 cut(s) 5
BfoI RGCGCY 1 cut(s) 193
Bme18I GGWCC 1 cut(s) 136
BmgT120I GGNCC 1 cut(s) 136
BmiI GGNNCC 1 cut(s) 137
BmsI GCATC 1 cut(s) 209
BmtI GCTAGC 1 cut(s) 8
BpiI GAAGAC 1 cut(s) 110
BpuEI CTTGAG 2 cut(s) 133, 191
BsaJI CCNNGG 1 cut(s) 221
Bse1I ACTGG 1 cut(s) 87
Bse3DI GCAATG 1 cut(s) 156
BseDI CCNNGG 1 cut(s) 221
BseGI GGATG 1 cut(s) 107
BseMI GCAATG 1 cut(s) 156
BseNI ACTGG 1 cut(s) 87
BslFI GGGAC 1 cut(s) 149
BsmFI GGGAC 1 cut(s) 149
BspLI GGNNCC 1 cut(s) 137
BspOI GCTAGC 1 cut(s) 8
BsrDI GCAATG 1 cut(s) 156
BsrI ACTGG 1 cut(s) 87
BssECI CCNNGG 1 cut(s) 221
BstC8I GCNNGC 1 cut(s) 6
BstDSI CCRYGG 1 cut(s) 221
BstF5I GGATG 1 cut(s) 107
BstH2I RGCGCY 1 cut(s) 193
BstHHI GCGC 1 cut(s) 192
BstMWI GCNNNNNNNGC 2 cut(s) 206, 223
BstNSI RCATGY 1 cut(s) 52
BstV2I GAAGAC 1 cut(s) 110
BtgI CCRYGG 1 cut(s) 221
BtsCI GGATG 1 cut(s) 107
Cac8I GCNNGC 1 cut(s) 6
CfoI GCGC 1 cut(s) 192
Cfr13I GGNCC 1 cut(s) 136
CseI GACGC 1 cut(s) 215
CviAII CATG 1 cut(s) 49
CviJI RGCY 3 cut(s) 124, 144, 226
CviKI_1 RGCY 3 cut(s) 124, 144, 226
Eco47I GGWCC 1 cut(s) 136
Eco57I CTGAAG 1 cut(s) 233
FaeI CATG 1 cut(s) 52
FaiI YATR 6 cut(s) 25, 50, 57, 232, 240, 248
FalI AAGNNNNNCTT 2 cut(s) 95, 127
FaqI GGGAC 1 cut(s) 149
FatI CATG 1 cut(s) 48
FokI GGATG 1 cut(s) 94
FspBI CTAG 1 cut(s) 5
GlaI GCGC 1 cut(s) 191
HaeII RGCGCY 1 cut(s) 193
HgaI GACGC 1 cut(s) 215
HhaI GCGC 1 cut(s) 192
Hin1II CATG 1 cut(s) 52
Hin6I GCGC 1 cut(s) 190
HinP1I GCGC 1 cut(s) 190
HindIII AAGCTT 1 cut(s) 142
HinfI GANTC 1 cut(s) 64
Hpy188I TCNGA 2 cut(s) 205, 213
Hpy188III TCNNGA 2 cut(s) 68, 255
HpyAV CCTTC 1 cut(s) 204
HpyCH4V TGCA 1 cut(s) 200
HpyF10VI GCNNNNNNNGC 2 cut(s) 206, 223
Hsp92II CATG 1 cut(s) 52
HspAI GCGC 1 cut(s) 190
LpnPI CCDG 4 cut(s) 53, 68, 104, 106
LweI GCATC 1 cut(s) 209
MaeI CTAG 1 cut(s) 5
MboII GAAGA 2 cut(s) 115, 196
MnlI CCTC 1 cut(s) 108
MwoI GCNNNNNNNGC 2 cut(s) 206, 223
NheI GCTAGC 1 cut(s) 4
NlaIII CATG 1 cut(s) 52
NlaIV GGNNCC 1 cut(s) 137
NspI RCATGY 1 cut(s) 52
PfeI GAWTC 1 cut(s) 64
PspN4I GGNNCC 1 cut(s) 137
PspPI GGNCC 1 cut(s) 136
Sau96I GGNCC 1 cut(s) 136
SetI ASST 3 cut(s) 93, 146, 247
SfaNI GCATC 1 cut(s) 209
SinI GGWCC 1 cut(s) 136
SmlI CTYRAG 2 cut(s) 112, 170
SmoI CTYRAG 2 cut(s) 112, 170
SspMI CTAG 1 cut(s) 5
TfiI GAWTC 1 cut(s) 64
TspDTI ATGAA 4 cut(s) 72, 136, 145, 255
TspGWI ACGGA 1 cut(s) 76
VpaK11BI GGWCC 1 cut(s) 136
XceI RCATGY 1 cut(s) 52
XspI CTAG 1 cut(s) 5
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.