Rmu_sc0004449.1_g000001

Protein kinase domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004449.1
OG0023734
Physical Location & Seq
Forward (+)
1 .. 1241
1241 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004449.1_g000001.1.cds

Sequence Viewer

Length: 333 bp
gtactcttccagaatgattcacccgcaactttacttgcacgggtgatgggaatcatttgccctattgatcaaagtatgcttgccaaaggacgggatacgtacaaatacttcacaaaaaatcacatgctttatgaacgaaatcaggaaacaaacagactggaatacctgataccaaaaaagacatctttaaggcatcggctgccaatgggggaccaagggttcattgattttgttgctcatctgcttgagataaacccaaagaagcgaccttctgcatctgaagctctgaagcacccatggctgtcatatccatatgaacccatatcatcttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0044424 GO:0044464
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Pkinase

Protein Analysis

110

Amino Acids

12.79

Weight (kDa)

9.3

Isoelectric Point (pI)

36.69

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0023734)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G03175
pyrus_communis pycom06g21010
rosa_multiflora Rmu_sc0004449.1_g000001

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 24
AcuI CTGAAG 2 cut(s) 300, 308
AfaI GTAC 2 cut(s) 3, 101
AfiI CCNNNNNNNGG 1 cut(s) 90
AloI GAACNNNNNNTCC 2 cut(s) 203, 235
AluBI AGCT 1 cut(s) 284
AluI AGCT 1 cut(s) 284
ApeKI GCWGC 1 cut(s) 199
AspS9I GGNCC 1 cut(s) 211
AsuHPI GGTGA 2 cut(s) 12, 55
AvaII GGWCC 1 cut(s) 211
BarI GAAGNNNNNNTAC 2 cut(s) 92, 124
BbvI GCAGC 1 cut(s) 186
BccI CCATC 1 cut(s) 40
BciVI GTATCC 1 cut(s) 88
BclI TGATCA 1 cut(s) 67
BfuI GTATCC 1 cut(s) 88
BisI GCNGC 1 cut(s) 200
BlsI GCNGC 1 cut(s) 201
Bme18I GGWCC 1 cut(s) 211
BmgT120I GGNCC 1 cut(s) 211
BmiI GGNNCC 1 cut(s) 212
BmsI GCATC 2 cut(s) 202, 284
BpuEI CTTGAG 1 cut(s) 266
BsaAI YACGTR 1 cut(s) 99
BsaBI GATNNNNATC 1 cut(s) 50
BsaJI CCNNGG 2 cut(s) 214, 296
Bsc4I CCNNNNNNNGG 1 cut(s) 90
Bse1I ACTGG 1 cut(s) 162
Bse8I GATNNNNATC 1 cut(s) 50
BseDI CCNNGG 2 cut(s) 214, 296
BseJI GATNNNNATC 1 cut(s) 50
BseLI CCNNNNNNNGG 1 cut(s) 90
BseNI ACTGG 1 cut(s) 162
BseXI GCAGC 1 cut(s) 186
BslFI GGGAC 1 cut(s) 224
BslI CCNNNNNNNGG 1 cut(s) 90
BsmFI GGGAC 1 cut(s) 224
Bsp143I GATC 1 cut(s) 67
Bsp19I CCATGG 1 cut(s) 296
BspACI CCGC 1 cut(s) 24
BspLI GGNNCC 1 cut(s) 212
BsrI ACTGG 1 cut(s) 162
BssECI CCNNGG 2 cut(s) 214, 296
BssMI GATC 1 cut(s) 67
BssT1I CCWWGG 2 cut(s) 214, 296
Bst6I CTCTTC 1 cut(s) 11
BstAPI GCANNNNNTGC 1 cut(s) 199
BstBAI YACGTR 1 cut(s) 99
BstC8I GCNNGC 1 cut(s) 81
BstDSI CCRYGG 1 cut(s) 296
BstKTI GATC 1 cut(s) 70
BstMBI GATC 1 cut(s) 67
BstMWI GCNNNNNNNGC 3 cut(s) 199, 281, 298
BstNSI RCATGY 1 cut(s) 127
BstSNI TACGTA 1 cut(s) 99
BstV1I GCAGC 1 cut(s) 186
BsuI GTATCC 1 cut(s) 88
BtgI CCRYGG 1 cut(s) 296
Cac8I GCNNGC 1 cut(s) 81
Cfr13I GGNCC 1 cut(s) 211
Csp6I GTAC 2 cut(s) 2, 100
CviAII CATG 2 cut(s) 124, 297
CviJI RGCY 3 cut(s) 199, 284, 301
CviKI_1 RGCY 3 cut(s) 199, 284, 301
CviQI GTAC 2 cut(s) 2, 100
DpnI GATC 1 cut(s) 69
DpnII GATC 1 cut(s) 67
Eam1104I CTCTTC 1 cut(s) 11
EarI CTCTTC 1 cut(s) 11
Eco105I TACGTA 1 cut(s) 99
Eco130I CCWWGG 2 cut(s) 214, 296
Eco47I GGWCC 1 cut(s) 211
Eco57I CTGAAG 2 cut(s) 300, 308
EcoT14I CCWWGG 2 cut(s) 214, 296
ErhI CCWWGG 2 cut(s) 214, 296
FaeI CATG 2 cut(s) 127, 300
FaiI YATR 8 cut(s) 77, 125, 132, 298, 307, 313, 315, 323
FaqI GGGAC 1 cut(s) 224
FatI CATG 2 cut(s) 123, 296
FauI CCCGC 1 cut(s) 31
FauNDI CATATG 1 cut(s) 313
FbaI TGATCA 1 cut(s) 67
Fnu4HI GCNGC 1 cut(s) 200
Fsp4HI GCNGC 1 cut(s) 200
GluI GCNGC 1 cut(s) 200
Hin1II CATG 2 cut(s) 127, 300
HinfI GANTC 2 cut(s) 17, 51
HphI GGTGA 2 cut(s) 12, 55
Hpy188I TCNGA 2 cut(s) 280, 288
Hpy188III TCNNGA 3 cut(s) 10, 143, 330
HpyAV CCTTC 1 cut(s) 279
HpyCH4IV ACGT 1 cut(s) 98
HpyCH4V TGCA 2 cut(s) 38, 275
HpyF10VI GCNNNNNNNGC 3 cut(s) 199, 281, 298
HpySE526I ACGT 1 cut(s) 98
Hsp92II CATG 2 cut(s) 127, 300
Ksp22I TGATCA 1 cut(s) 67
Kzo9I GATC 1 cut(s) 67
LpnPI CCDG 4 cut(s) 23, 128, 143, 179
Lsp1109I GCAGC 1 cut(s) 186
LweI GCATC 2 cut(s) 202, 284
MaeII ACGT 1 cut(s) 98
MalI GATC 1 cut(s) 69
MboI GATC 1 cut(s) 67
MseI TTAA 1 cut(s) 188
MwoI GCNNNNNNNGC 3 cut(s) 199, 281, 298
NcoI CCATGG 1 cut(s) 296
NdeI CATATG 1 cut(s) 313
NdeII GATC 1 cut(s) 67
NlaIII CATG 2 cut(s) 127, 300
NlaIV GGNNCC 1 cut(s) 212
NspI RCATGY 1 cut(s) 127
PfeI GAWTC 2 cut(s) 17, 51
PkrI GCNGC 1 cut(s) 201
Ppu21I YACGTR 1 cut(s) 99
PspN4I GGNNCC 1 cut(s) 212
PspPI GGNCC 1 cut(s) 211
RsaI GTAC 2 cut(s) 3, 101
RsaNI GTAC 2 cut(s) 2, 100
SaqAI TTAA 1 cut(s) 188
SatI GCNGC 1 cut(s) 200
Sau3AI GATC 1 cut(s) 67
Sau96I GGNCC 1 cut(s) 211
SetI ASST 4 cut(s) 101, 168, 271, 286
SfaNI GCATC 2 cut(s) 202, 284
SinI GGWCC 1 cut(s) 211
SmlI CTYRAG 1 cut(s) 245
SmoI CTYRAG 1 cut(s) 245
SnaBI TACGTA 1 cut(s) 99
SsiI CCGC 1 cut(s) 24
StyI CCWWGG 2 cut(s) 214, 296
TaiI ACGT 1 cut(s) 101
TfiI GAWTC 2 cut(s) 17, 51
Tru1I TTAA 1 cut(s) 188
Tru9I TTAA 1 cut(s) 188
TseI GCWGC 1 cut(s) 199
TspDTI ATGAA 3 cut(s) 147, 211, 330
VpaK11BI GGWCC 1 cut(s) 211
XceI RCATGY 1 cut(s) 127
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.