pycom08g13250

hydroxyproline O-arabinosyltransferase activity

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr8
OG0024659
Physical Location & Seq
Reverse (-)
11871249 .. 11871934
686 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom08g13250.1

Sequence Viewer

Length: 255 bp
ATGCTTCAGCCTCCGTGGGATAAAAAAATTGGCAAGAAGTTCATAATTCATTACACTTATGGATGTGACTATAATATGAAGGGTGAACTAACATATGGGAAAATTGGAGAATGGAGATTTGATAAAAGGTCTTATGATACTGTCGCACCGCCTAGAAACCTTACTATGCCTCCACATGGTGTTCCAGAAAGCGTGGTGACCCTGGTGAAAATGGTGAATGAAGCCACAGCAAACATTCCAAAGTGGGGGGAATAG

Protein Analysis

85

Amino Acids

9.69

Weight (kDa)

9.07

Isoelectric Point (pI)

48.3

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
HPAT PF23452 1 - 82 4e-29 Hydroxyproline O-arabinosyltransferase family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0024659)

Species Orthologous Gene IDs
pyrus_communis pycom08g13230 pycom08g13250
rosa_samantha Rh5AG333900

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 149
AdeI CACNNNGTG 1 cut(s) 179
AfiI CCNNNNNNNGG 2 cut(s) 176, 245
AjnI CCWGG 1 cut(s) 201
AsuHPI GGTGA 4 cut(s) 95, 208, 217, 226
BciT130I CCWGG 1 cut(s) 203
BfaI CTAG 1 cut(s) 153
Bme1390I CCNGG 1 cut(s) 203
BmrFI CCNGG 1 cut(s) 203
BsaJI CCNNGG 2 cut(s) 14, 201
BsaXI ACNNNNNCTCC 2 cut(s) 154, 184
Bsc4I CCNNNNNNNGG 2 cut(s) 176, 245
BseBI CCWGG 1 cut(s) 203
BseDI CCNNGG 2 cut(s) 14, 201
BseGI GGATG 1 cut(s) 68
BseLI CCNNNNNNNGG 2 cut(s) 176, 245
BslI CCNNNNNNNGG 2 cut(s) 176, 245
BspACI CCGC 1 cut(s) 149
BssECI CCNNGG 2 cut(s) 14, 201
Bst2UI CCWGG 1 cut(s) 203
Bst4CI ACNGT 1 cut(s) 142
BstDSI CCRYGG 1 cut(s) 14
BstEII GGTNACC 1 cut(s) 196
BstF5I GGATG 1 cut(s) 68
BstNI CCWGG 1 cut(s) 203
BstPI GGTNACC 1 cut(s) 196
BstSCI CCNGG 1 cut(s) 201
BtgI CCRYGG 1 cut(s) 14
BtsCI GGATG 1 cut(s) 68
CviAII CATG 1 cut(s) 176
CviJI RGCY 2 cut(s) 10, 224
CviKI_1 RGCY 2 cut(s) 10, 224
DraIII CACNNNGTG 1 cut(s) 179
Eco91I GGTNACC 1 cut(s) 196
EcoO65I GGTNACC 1 cut(s) 196
EcoRII CCWGG 1 cut(s) 201
FaeI CATG 1 cut(s) 179
FaiI YATR 9 cut(s) 44, 60, 72, 77, 94, 96, 135, 167, 177
FatI CATG 1 cut(s) 175
FauNDI CATATG 1 cut(s) 94
FokI GGATG 1 cut(s) 75
FspBI CTAG 1 cut(s) 153
Hin1II CATG 1 cut(s) 179
HphI GGTGA 4 cut(s) 95, 208, 217, 226
Hpy166II GTNNAC 1 cut(s) 86
Hpy188III TCNNGA 1 cut(s) 185
Hpy8I GTNNAC 1 cut(s) 86
HpyAV CCTTC 1 cut(s) 73
HpyCH4III ACNGT 1 cut(s) 142
Hsp92II CATG 1 cut(s) 179
LpnPI CCDG 3 cut(s) 188, 198, 215
MaeI CTAG 1 cut(s) 153
MaeIII GTNAC 2 cut(s) 65, 196
MluCI AATT 3 cut(s) 27, 45, 102
MnlI CCTC 2 cut(s) 21, 180
MspR9I CCNGG 1 cut(s) 203
MvaI CCWGG 1 cut(s) 203
NdeI CATATG 1 cut(s) 94
NlaIII CATG 1 cut(s) 179
NmuCI GTSAC 2 cut(s) 65, 196
Psp6I CCWGG 1 cut(s) 201
PspEI GGTNACC 1 cut(s) 196
PspGI CCWGG 1 cut(s) 201
ScrFI CCNGG 1 cut(s) 203
SetI ASST 2 cut(s) 131, 162
SgeI CNNG 8 cut(s) 27, 46, 165, 188, 197, 205, 214, 215
Sse9I AATT 3 cut(s) 27, 45, 102
SsiI CCGC 1 cut(s) 149
SspMI CTAG 1 cut(s) 153
StyD4I CCNGG 1 cut(s) 201
TaaI ACNGT 1 cut(s) 142
TasI AATT 3 cut(s) 27, 45, 102
TseFI GTSAC 2 cut(s) 65, 196
Tsp45I GTSAC 2 cut(s) 65, 196
TspDTI ATGAA 4 cut(s) 31, 38, 92, 234
XspI CTAG 1 cut(s) 153
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.