Rh5AG333900

hydroxyproline O-arabinosyltransferase activity

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
OG0024659
Physical Location & Seq
Reverse (-)
53414929 .. 53416260
1332 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG333900.1

Sequence Viewer

Length: 201 bp
ATGAGTGGCAGTTTAGCTGCAATCGGGGAACTGACTTATGGGAAGGTTGGAGAATGGCGTTTTGACAAGAGATCATATCTCAGTGGTCCTCCACCAAGAAACCTCTCCTTGCCCCCTCCAGGAGTTCCTGAAAGTGTGGTAAGGCTTGTGAAGATGGTTAATGAGGCAACTGCCAACATTCCTGGGTGGGACATTGACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00514 map00514
Pfam Domains
Protein Families
No domains found.

Protein Analysis

66

Amino Acids

7.14

Weight (kDa)

6.15

Isoelectric Point (pI)

55.36

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
HPAT PF23452 8 - 64 6.8e-17 Hydroxyproline O-arabinosyltransferase family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0024659)

Species Orthologous Gene IDs
pyrus_communis pycom08g13230 pycom08g13250
rosa_samantha Rh5AG333900

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 119
AjnI CCWGG 2 cut(s) 118, 181
AluBI AGCT 1 cut(s) 17
AluI AGCT 1 cut(s) 17
ApeKI GCWGC 1 cut(s) 17
AspS9I GGNCC 1 cut(s) 86
AvaII GGWCC 1 cut(s) 86
BbvI GCAGC 1 cut(s) 4
BccI CCATC 1 cut(s) 148
BciT130I CCWGG 2 cut(s) 120, 183
BfaI CTAG 1 cut(s) 199
BisI GCNGC 1 cut(s) 18
BlsI GCNGC 1 cut(s) 19
Bme1390I CCNGG 2 cut(s) 120, 183
Bme18I GGWCC 1 cut(s) 86
BmgT120I GGNCC 1 cut(s) 86
BmrFI CCNGG 2 cut(s) 120, 183
BpmI CTGGAG 1 cut(s) 102
BsaJI CCNNGG 1 cut(s) 182
Bsc4I CCNNNNNNNGG 1 cut(s) 119
BseBI CCWGG 2 cut(s) 120, 183
BseDI CCNNGG 1 cut(s) 182
BseLI CCNNNNNNNGG 1 cut(s) 119
BseMII CTCAG 1 cut(s) 94
BseXI GCAGC 1 cut(s) 4
BslI CCNNNNNNNGG 1 cut(s) 119
Bsp143I GATC 1 cut(s) 71
BspCNI CTCAG 1 cut(s) 93
BssECI CCNNGG 1 cut(s) 182
BssMI GATC 1 cut(s) 71
Bst2UI CCWGG 2 cut(s) 120, 183
BstDEI CTNAG 1 cut(s) 80
BstKTI GATC 1 cut(s) 74
BstMBI GATC 1 cut(s) 71
BstNI CCWGG 2 cut(s) 120, 183
BstSCI CCNGG 2 cut(s) 118, 181
BstV1I GCAGC 1 cut(s) 4
BtsIMutI CAGTG 1 cut(s) 88
Cfr13I GGNCC 1 cut(s) 86
CviJI RGCY 2 cut(s) 17, 145
CviKI_1 RGCY 2 cut(s) 17, 145
DdeI CTNAG 1 cut(s) 80
DpnI GATC 1 cut(s) 73
DpnII GATC 1 cut(s) 71
Eco47I GGWCC 1 cut(s) 86
EcoRII CCWGG 2 cut(s) 118, 181
FaiI YATR 2 cut(s) 39, 76
Fnu4HI GCNGC 1 cut(s) 18
Fsp4HI GCNGC 1 cut(s) 18
FspBI CTAG 1 cut(s) 199
GluI GCNGC 1 cut(s) 18
GsuI CTGGAG 1 cut(s) 102
Hpy188III TCNNGA 1 cut(s) 128
HpyAV CCTTC 1 cut(s) 37
HpyCH4V TGCA 1 cut(s) 20
HpyF3I CTNAG 1 cut(s) 80
Kzo9I GATC 1 cut(s) 71
LpnPI CCDG 5 cut(s) 105, 132, 141, 168, 195
Lsp1109I GCAGC 1 cut(s) 4
MaeI CTAG 1 cut(s) 199
MalI GATC 1 cut(s) 73
MboI GATC 1 cut(s) 71
MboII GAAGA 1 cut(s) 163
MmeI TCCRAC 1 cut(s) 28
MnlI CCTC 4 cut(s) 99, 113, 126, 157
MseI TTAA 1 cut(s) 159
MspR9I CCNGG 2 cut(s) 120, 183
MvaI CCWGG 2 cut(s) 120, 183
NdeII GATC 1 cut(s) 71
PfoI TCCNGGA 1 cut(s) 118
PkrI GCNGC 1 cut(s) 19
Psp6I CCWGG 2 cut(s) 118, 181
PspGI CCWGG 2 cut(s) 118, 181
PspPI GGNCC 1 cut(s) 86
SaqAI TTAA 1 cut(s) 159
SatI GCNGC 1 cut(s) 18
Sau3AI GATC 1 cut(s) 71
Sau96I GGNCC 1 cut(s) 86
ScrFI CCNGG 2 cut(s) 120, 183
SetI ASST 3 cut(s) 19, 48, 105
SinI GGWCC 1 cut(s) 86
SspMI CTAG 1 cut(s) 199
StyD4I CCNGG 2 cut(s) 118, 181
Tru1I TTAA 1 cut(s) 159
Tru9I TTAA 1 cut(s) 159
TscAI CASTG 1 cut(s) 88
TseI GCWGC 1 cut(s) 17
TspRI CASTG 1 cut(s) 88
VpaK11BI GGWCC 1 cut(s) 86
XspI CTAG 1 cut(s) 199
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.