pycom09g05970

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr9
Physical Location & Seq
Forward (+)
4442258 .. 4442730
473 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 312 bp
ATGTATAGTTGGAATAGATGTGATGCGCCTTATCCACTCTCAGCGAAGACCACTAGATATTCTACAGAAATAGGAAGCGAAAGGAAATCAAAGAAAAACATGGACGGGATACAACAACTAGGTCTTCCAGTTCTAGGAATTGTAGCTGCTGCAGCTGTTACCTTCTATGCTGTCAGCTTTCTTGAGCTTAGTGAGAAATCGTTTAGGGATCTGGACGAGAAAGAATATGGTGAAAGTGGTGGATATAAGCCATCTCCAAGCTCTAGGGTAAGGCGCGCCAGAAGAAAAGCTGAAAAACAAGCCAAACGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

104

Amino Acids

11.61

Weight (kDa)

9.79

Isoelectric Point (pI)

62.34

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017203)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G22210
fragaria_vesca FvH4_6g39540
malus_domestica MD09G1139100.v1.1
prunus_persica Prupe.3G186600_v2.0.a1
pyrus_communis pycom09g05970
rosa_chinensis RchiOBHm_Chr2g0153601
rosa_multiflora Rmu_sc0025899.1_g000001 Rmu_ssc0000024.1_g000015
rosa_roxburghii Rroxscaffold_2G00094880
rosa_rugosa Rorug02G0440800
rosa_samantha Rh2AG503700 Rh2BG514400
rosa_wichuraiana Rw2G041370

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 276
AclI AACGTT 1 cut(s) 307
AclWI GGATC 1 cut(s) 216
AfiI CCNNNNNNNGG 1 cut(s) 134
AluBI AGCT 6 cut(s) 146, 155, 177, 187, 261, 290
AluI AGCT 6 cut(s) 146, 155, 177, 187, 261, 290
AlwI GGATC 1 cut(s) 216
ApeKI GCWGC 3 cut(s) 146, 149, 152
AscI GGCGCGCC 1 cut(s) 274
AspLEI GCGC 3 cut(s) 28, 276, 278
AsuHPI GGTGA 1 cut(s) 242
BbsI GAAGAC 2 cut(s) 53, 116
BbvI GCAGC 3 cut(s) 133, 136, 164
BccI CCATC 1 cut(s) 259
BciVI GTATCC 1 cut(s) 102
BfaI CTAG 4 cut(s) 54, 119, 134, 264
BfmI CTRYAG 2 cut(s) 63, 150
BfuI GTATCC 1 cut(s) 102
BisI GCNGC 3 cut(s) 147, 150, 153
BlsI GCNGC 3 cut(s) 148, 151, 154
BmsI GCATC 1 cut(s) 13
BpiI GAAGAC 2 cut(s) 53, 116
BpuEI CTTGAG 1 cut(s) 203
Bsc4I CCNNNNNNNGG 1 cut(s) 134
Bse1I ACTGG 1 cut(s) 128
BseLI CCNNNNNNNGG 1 cut(s) 134
BseMII CTCAG 1 cut(s) 54
BseNI ACTGG 1 cut(s) 128
BsePI GCGCGC 1 cut(s) 274
BseXI GCAGC 3 cut(s) 133, 136, 164
Bsh1236I CGCG 1 cut(s) 276
BslI CCNNNNNNNGG 1 cut(s) 134
Bsp143I GATC 1 cut(s) 208
BspCNI CTCAG 1 cut(s) 53
BspFNI CGCG 1 cut(s) 276
BspMAI CTGCAG 1 cut(s) 154
BspPI GGATC 1 cut(s) 216
BsrI ACTGG 1 cut(s) 128
BssHII GCGCGC 1 cut(s) 274
BssMI GATC 1 cut(s) 208
BstC8I GCNNGC 1 cut(s) 276
BstDEI CTNAG 2 cut(s) 40, 188
BstFNI CGCG 1 cut(s) 276
BstHHI GCGC 3 cut(s) 28, 276, 278
BstKTI GATC 1 cut(s) 211
BstMBI GATC 1 cut(s) 208
BstMWI GCNNNNNNNGC 1 cut(s) 152
BstSFI CTRYAG 2 cut(s) 63, 150
BstUI CGCG 1 cut(s) 276
BstV1I GCAGC 3 cut(s) 133, 136, 164
BstV2I GAAGAC 2 cut(s) 53, 116
BstX2I RGATCY 1 cut(s) 208
BstYI RGATCY 1 cut(s) 208
BsuI GTATCC 1 cut(s) 102
Cac8I GCNNGC 1 cut(s) 276
CfoI GCGC 3 cut(s) 28, 276, 278
CviAII CATG 1 cut(s) 100
CviJI RGCY 8 cut(s) 146, 155, 177, 187, 250, 261, 290, 302
CviKI_1 RGCY 8 cut(s) 146, 155, 177, 187, 250, 261, 290, 302
DdeI CTNAG 2 cut(s) 40, 188
DpnI GATC 1 cut(s) 210
DpnII GATC 1 cut(s) 208
FaeI CATG 1 cut(s) 103
FaiI YATR 5 cut(s) 6, 101, 168, 228, 246
FatI CATG 1 cut(s) 99
Fnu4HI GCNGC 3 cut(s) 147, 150, 153
Fsp4HI GCNGC 3 cut(s) 147, 150, 153
FspBI CTAG 4 cut(s) 54, 119, 134, 264
GlaI GCGC 3 cut(s) 27, 275, 277
GluI GCNGC 3 cut(s) 147, 150, 153
HhaI GCGC 3 cut(s) 28, 276, 278
Hin1II CATG 1 cut(s) 103
Hin6I GCGC 3 cut(s) 26, 274, 276
HinP1I GCGC 3 cut(s) 26, 274, 276
HphI GGTGA 1 cut(s) 242
Hpy188III TCNNGA 2 cut(s) 182, 212
HpyAV CCTTC 1 cut(s) 172
HpyCH4IV ACGT 1 cut(s) 307
HpyCH4V TGCA 1 cut(s) 152
HpyF10VI GCNNNNNNNGC 1 cut(s) 152
HpyF3I CTNAG 2 cut(s) 40, 188
HpySE526I ACGT 1 cut(s) 307
Hsp92II CATG 1 cut(s) 103
HspAI GCGC 3 cut(s) 26, 274, 276
Kzo9I GATC 1 cut(s) 208
LpnPI CCDG 3 cut(s) 141, 197, 292
Lsp1109I GCAGC 3 cut(s) 133, 136, 164
LweI GCATC 1 cut(s) 13
MaeI CTAG 4 cut(s) 54, 119, 134, 264
MaeII ACGT 1 cut(s) 307
MaeIII GTNAC 1 cut(s) 157
MalI GATC 1 cut(s) 210
MboI GATC 1 cut(s) 208
MboII GAAGA 3 cut(s) 58, 116, 294
MflI RGATCY 1 cut(s) 208
MluCI AATT 1 cut(s) 138
MspA1I CMGCKG 1 cut(s) 155
MvnI CGCG 1 cut(s) 276
MwoI GCNNNNNNNGC 1 cut(s) 152
NdeII GATC 1 cut(s) 208
NlaIII CATG 1 cut(s) 103
PalAI GGCGCGCC 1 cut(s) 274
PauI GCGCGC 1 cut(s) 274
PkrI GCNGC 3 cut(s) 148, 151, 154
Psp1406I AACGTT 1 cut(s) 307
PstI CTGCAG 1 cut(s) 154
PsuI RGATCY 1 cut(s) 208
PteI GCGCGC 1 cut(s) 274
PvuII CAGCTG 1 cut(s) 155
SatI GCNGC 3 cut(s) 147, 150, 153
Sau3AI GATC 1 cut(s) 208
SetI ASST 9 cut(s) 124, 148, 157, 164, 179, 189, 263, 292, 310
SfaNI GCATC 1 cut(s) 13
SfcI CTRYAG 2 cut(s) 63, 150
SgsI GGCGCGCC 1 cut(s) 274
SmlI CTYRAG 1 cut(s) 182
SmoI CTYRAG 1 cut(s) 182
Sse9I AATT 1 cut(s) 138
SspMI CTAG 4 cut(s) 54, 119, 134, 264
TaiI ACGT 1 cut(s) 310
TasI AATT 1 cut(s) 138
TseI GCWGC 3 cut(s) 146, 149, 152
XspI CTAG 4 cut(s) 54, 119, 134, 264
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.