Rmu_sc0025899.1_g000001

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0025899.1
Physical Location & Seq
Reverse (-)
1 .. 834
834 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0025899.1_g000001.1.cds

Sequence Viewer

Length: 165 bp
atggatggattgcagcaacttggtcttcctgttctgggtattgtagcagctgcagctatcaccttctatgttgtgagcttttctgagctaagcgagaaatcttttagggacttggataaaaaagattacgatgatgaaggatataagccatctccaagctcgagg
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

55

Amino Acids

6.06

Weight (kDa)

4.52

Isoelectric Point (pI)

60.18

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017203)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G22210
fragaria_vesca FvH4_6g39540
malus_domestica MD09G1139100.v1.1
prunus_persica Prupe.3G186600_v2.0.a1
pyrus_communis pycom09g05970
rosa_chinensis RchiOBHm_Chr2g0153601
rosa_multiflora Rmu_sc0025899.1_g000001 Rmu_ssc0000024.1_g000015
rosa_roxburghii Rroxscaffold_2G00094880
rosa_rugosa Rorug02G0440800
rosa_samantha Rh2AG503700 Rh2BG514400
rosa_wichuraiana Rw2G041370

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 35
AluBI AGCT 5 cut(s) 50, 56, 78, 88, 159
AluI AGCT 5 cut(s) 50, 56, 78, 88, 159
Ama87I CYCGRG 1 cut(s) 160
ApeKI GCWGC 4 cut(s) 13, 47, 50, 53
AsuHPI GGTGA 1 cut(s) 52
AvaI CYCGRG 1 cut(s) 160
BbsI GAAGAC 1 cut(s) 17
BbvI GCAGC 4 cut(s) 25, 37, 59, 65
BccI CCATC 1 cut(s) 157
BfmI CTRYAG 1 cut(s) 51
BisI GCNGC 4 cut(s) 14, 48, 51, 54
BlpI GCTNAGC 1 cut(s) 89
BlsI GCNGC 4 cut(s) 15, 49, 52, 55
BmeT110I CYCGRG 1 cut(s) 160
BpiI GAAGAC 1 cut(s) 17
Bpu1102I GCTNAGC 1 cut(s) 89
Bsc4I CCNNNNNNNGG 1 cut(s) 35
BseGI GGATG 1 cut(s) 10
BseLI CCNNNNNNNGG 1 cut(s) 35
BseMII CTCAG 1 cut(s) 75
BseXI GCAGC 4 cut(s) 25, 37, 59, 65
BsiHKCI CYCGRG 1 cut(s) 160
BslFI GGGAC 1 cut(s) 122
BslI CCNNNNNNNGG 1 cut(s) 35
BsmFI GGGAC 1 cut(s) 122
BsoBI CYCGRG 1 cut(s) 160
Bsp1720I GCTNAGC 1 cut(s) 89
BspCNI CTCAG 1 cut(s) 76
BspMAI CTGCAG 1 cut(s) 55
BstDEI CTNAG 2 cut(s) 84, 89
BstF5I GGATG 1 cut(s) 10
BstMWI GCNNNNNNNGC 1 cut(s) 53
BstSFI CTRYAG 1 cut(s) 51
BstV1I GCAGC 4 cut(s) 25, 37, 59, 65
BstV2I GAAGAC 1 cut(s) 17
BtsCI GGATG 1 cut(s) 10
CviJI RGCY 6 cut(s) 50, 56, 78, 88, 148, 159
CviKI_1 RGCY 6 cut(s) 50, 56, 78, 88, 148, 159
DdeI CTNAG 2 cut(s) 84, 89
Eco88I CYCGRG 1 cut(s) 160
FaiI YATR 2 cut(s) 69, 144
FaqI GGGAC 1 cut(s) 122
Fnu4HI GCNGC 4 cut(s) 14, 48, 51, 54
FokI GGATG 1 cut(s) 17
Fsp4HI GCNGC 4 cut(s) 14, 48, 51, 54
GluI GCNGC 4 cut(s) 14, 48, 51, 54
HphI GGTGA 1 cut(s) 52
Hpy188I TCNGA 1 cut(s) 85
HpyAV CCTTC 2 cut(s) 73, 131
HpyCH4V TGCA 2 cut(s) 13, 53
HpyF10VI GCNNNNNNNGC 1 cut(s) 53
HpyF3I CTNAG 2 cut(s) 84, 89
LpnPI CCDG 2 cut(s) 20, 42
Lsp1109I GCAGC 4 cut(s) 25, 37, 59, 65
MboII GAAGA 1 cut(s) 17
MnlI CCTC 1 cut(s) 156
MspA1I CMGCKG 1 cut(s) 50
MwoI GCNNNNNNNGC 1 cut(s) 53
PaeR7I CTCGAG 1 cut(s) 160
PkrI GCNGC 4 cut(s) 15, 49, 52, 55
PspXI VCTCGAGB 1 cut(s) 160
PstI CTGCAG 1 cut(s) 55
PvuII CAGCTG 1 cut(s) 50
SatI GCNGC 4 cut(s) 14, 48, 51, 54
SetI ASST 6 cut(s) 52, 58, 65, 80, 90, 161
SfcI CTRYAG 1 cut(s) 51
Sfr274I CTCGAG 1 cut(s) 160
SgeI CNNG 5 cut(s) 32, 41, 47, 106, 124
SlaI CTCGAG 1 cut(s) 160
SmlI CTYRAG 1 cut(s) 160
SmoI CTYRAG 1 cut(s) 160
TaqI TCGA 1 cut(s) 161
TseI GCWGC 4 cut(s) 13, 47, 50, 53
TspDTI ATGAA 1 cut(s) 150
XhoI CTCGAG 1 cut(s) 160
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.