Rroxscaffold_2G00094880

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Forward (+)
16237905 .. 16238351
447 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00094880.1

Sequence Viewer

Length: 210 bp
ATGGATGGATTGCAGCAACTTGGTCTTCCTGTTCTGGGTATTGTAGCAGCTGCAGCTATCACCTTCTATGTTGTGAGCTTTTCGGAGCTAAGCGAGAAATCTTTTAGGGACTTGGATAAAAAAGATTACGATGATGAAGGATATAAGCCATCTCCAAGCTCGAGGGTAAAGCGGGCCAGAAGAAAAGCTAACAAACAATCCAAGAGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

69

Amino Acids

7.69

Weight (kDa)

9.57

Isoelectric Point (pI)

75.83

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017203)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G22210
fragaria_vesca FvH4_6g39540
malus_domestica MD09G1139100.v1.1
prunus_persica Prupe.3G186600_v2.0.a1
pyrus_communis pycom09g05970
rosa_chinensis RchiOBHm_Chr2g0153601
rosa_multiflora Rmu_sc0025899.1_g000001 Rmu_ssc0000024.1_g000015
rosa_roxburghii Rroxscaffold_2G00094880
rosa_rugosa Rorug02G0440800
rosa_samantha Rh2AG503700 Rh2BG514400
rosa_wichuraiana Rw2G041370

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 172
AfiI CCNNNNNNNGG 1 cut(s) 35
AluBI AGCT 6 cut(s) 50, 56, 78, 88, 159, 188
AluI AGCT 6 cut(s) 50, 56, 78, 88, 159, 188
Ama87I CYCGRG 1 cut(s) 160
AoxI GGCC 1 cut(s) 174
ApeKI GCWGC 4 cut(s) 13, 47, 50, 53
AspS9I GGNCC 1 cut(s) 174
AsuHPI GGTGA 1 cut(s) 52
AvaI CYCGRG 1 cut(s) 160
BbsI GAAGAC 1 cut(s) 17
BbvI GCAGC 4 cut(s) 25, 37, 59, 65
BccI CCATC 1 cut(s) 157
BfmI CTRYAG 1 cut(s) 51
BisI GCNGC 4 cut(s) 14, 48, 51, 54
BlpI GCTNAGC 1 cut(s) 89
BlsI GCNGC 4 cut(s) 15, 49, 52, 55
BmeT110I CYCGRG 1 cut(s) 160
BmgT120I GGNCC 1 cut(s) 174
BpiI GAAGAC 1 cut(s) 17
Bpu1102I GCTNAGC 1 cut(s) 89
Bsc4I CCNNNNNNNGG 1 cut(s) 35
BseGI GGATG 1 cut(s) 10
BseLI CCNNNNNNNGG 1 cut(s) 35
BseXI GCAGC 4 cut(s) 25, 37, 59, 65
BshFI GGCC 1 cut(s) 176
BsiHKCI CYCGRG 1 cut(s) 160
BslFI GGGAC 1 cut(s) 122
BslI CCNNNNNNNGG 1 cut(s) 35
BsmFI GGGAC 1 cut(s) 122
BsnI GGCC 1 cut(s) 176
BsoBI CYCGRG 1 cut(s) 160
Bsp1720I GCTNAGC 1 cut(s) 89
BspACI CCGC 1 cut(s) 172
BspANI GGCC 1 cut(s) 176
BspMAI CTGCAG 1 cut(s) 55
BstC8I GCNNGC 1 cut(s) 174
BstDEI CTNAG 1 cut(s) 89
BstF5I GGATG 1 cut(s) 10
BstMWI GCNNNNNNNGC 1 cut(s) 53
BstSFI CTRYAG 1 cut(s) 51
BstV1I GCAGC 4 cut(s) 25, 37, 59, 65
BstV2I GAAGAC 1 cut(s) 17
BsuRI GGCC 1 cut(s) 176
BtsCI GGATG 1 cut(s) 10
Cac8I GCNNGC 1 cut(s) 174
Cfr13I GGNCC 1 cut(s) 174
CviJI RGCY 8 cut(s) 50, 56, 78, 88, 148, 159, 176, 188
CviKI_1 RGCY 8 cut(s) 50, 56, 78, 88, 148, 159, 176, 188
DdeI CTNAG 1 cut(s) 89
Eco88I CYCGRG 1 cut(s) 160
FaiI YATR 2 cut(s) 69, 144
FaqI GGGAC 1 cut(s) 122
FauI CCCGC 1 cut(s) 165
Fnu4HI GCNGC 4 cut(s) 14, 48, 51, 54
FokI GGATG 1 cut(s) 17
Fsp4HI GCNGC 4 cut(s) 14, 48, 51, 54
GluI GCNGC 4 cut(s) 14, 48, 51, 54
HaeIII GGCC 1 cut(s) 176
HphI GGTGA 1 cut(s) 52
Hpy188I TCNGA 1 cut(s) 85
HpyAV CCTTC 2 cut(s) 73, 131
HpyCH4V TGCA 2 cut(s) 13, 53
HpyF10VI GCNNNNNNNGC 1 cut(s) 53
HpyF3I CTNAG 1 cut(s) 89
LmnI GCTCC 1 cut(s) 85
LpnPI CCDG 3 cut(s) 20, 42, 190
Lsp1109I GCAGC 4 cut(s) 25, 37, 59, 65
MboII GAAGA 2 cut(s) 17, 192
MnlI CCTC 1 cut(s) 156
MseI TTAA 1 cut(s) 208
MspA1I CMGCKG 1 cut(s) 50
MwoI GCNNNNNNNGC 1 cut(s) 53
PaeR7I CTCGAG 1 cut(s) 160
PkrI GCNGC 4 cut(s) 15, 49, 52, 55
PspPI GGNCC 1 cut(s) 174
PspXI VCTCGAGB 1 cut(s) 160
PstI CTGCAG 1 cut(s) 55
PvuII CAGCTG 1 cut(s) 50
SaqAI TTAA 1 cut(s) 208
SatI GCNGC 4 cut(s) 14, 48, 51, 54
Sau96I GGNCC 1 cut(s) 174
SetI ASST 7 cut(s) 52, 58, 65, 80, 90, 161, 190
SfcI CTRYAG 1 cut(s) 51
Sfr274I CTCGAG 1 cut(s) 160
SlaI CTCGAG 1 cut(s) 160
SmlI CTYRAG 1 cut(s) 160
SmoI CTYRAG 1 cut(s) 160
SsiI CCGC 1 cut(s) 172
TaqI TCGA 1 cut(s) 161
Tru1I TTAA 1 cut(s) 208
Tru9I TTAA 1 cut(s) 208
TseI GCWGC 4 cut(s) 13, 47, 50, 53
TspDTI ATGAA 1 cut(s) 150
XhoI CTCGAG 1 cut(s) 160
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.