pycom09g13890

quinone oxidoreductase

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr9
Physical Location & Seq
Forward (+)
13068269 .. 13068499
231 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 231 bp
ATGCCATTGACCAGAGGCGAAGTGATAGATGTATTGGTAATCCCAGATCTCAGCGACAAGGTGATTTTGGTAAAGGAAATGTACCTTTGTGCTGTAGGTACAATAATGGACACCTTTGAGAATGTAGGCAAGAAAGCAGTGGACGCTTTACAAGTGGATAGATGGGACATAGAACTGCAAATTATGTCCAAAGCCAACAGAATCCCTAGCAGTCTTCTTTGCCACAACTAG

Protein Analysis

77

Amino Acids

8.51

Weight (kDa)

4.87

Isoelectric Point (pI)

44.22

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0020433)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 2 cut(s) 83, 100
AsuHPI GGTGA 1 cut(s) 73
BbsI GAAGAC 1 cut(s) 206
BccI CCATC 1 cut(s) 156
BfaI CTAG 2 cut(s) 207, 229
BfmI CTRYAG 1 cut(s) 93
BglII AGATCT 1 cut(s) 46
BpiI GAAGAC 1 cut(s) 206
BseMII CTCAG 1 cut(s) 64
BslFI GGGAC 1 cut(s) 179
BsmFI GGGAC 1 cut(s) 179
Bsp143I GATC 1 cut(s) 46
BspCNI CTCAG 1 cut(s) 63
BssMI GATC 1 cut(s) 46
BstDEI CTNAG 1 cut(s) 50
BstKTI GATC 1 cut(s) 49
BstMBI GATC 1 cut(s) 46
BstMWI GCNNNNNNNGC 1 cut(s) 143
BstSFI CTRYAG 1 cut(s) 93
BstV2I GAAGAC 1 cut(s) 206
BstX2I RGATCY 1 cut(s) 46
BstYI RGATCY 1 cut(s) 46
BtsI GCAGTG 1 cut(s) 144
BtsIMutI CAGTG 1 cut(s) 144
CseI GACGC 1 cut(s) 152
Csp6I GTAC 2 cut(s) 82, 99
CviJI RGCY 1 cut(s) 194
CviKI_1 RGCY 1 cut(s) 194
CviQI GTAC 2 cut(s) 82, 99
DdeI CTNAG 1 cut(s) 50
DpnI GATC 1 cut(s) 48
DpnII GATC 1 cut(s) 46
FaiI YATR 2 cut(s) 170, 185
FaqI GGGAC 1 cut(s) 179
FspBI CTAG 2 cut(s) 207, 229
HgaI GACGC 1 cut(s) 152
HinfI GANTC 1 cut(s) 201
HphI GGTGA 1 cut(s) 73
Hpy166II GTNNAC 1 cut(s) 142
Hpy8I GTNNAC 1 cut(s) 142
HpyCH4V TGCA 1 cut(s) 178
HpyF10VI GCNNNNNNNGC 1 cut(s) 143
HpyF3I CTNAG 1 cut(s) 50
Kzo9I GATC 1 cut(s) 46
LpnPI CCDG 2 cut(s) 25, 57
MaeI CTAG 2 cut(s) 207, 229
MalI GATC 1 cut(s) 48
MboI GATC 1 cut(s) 46
MboII GAAGA 1 cut(s) 206
MflI RGATCY 1 cut(s) 46
MluCI AATT 1 cut(s) 180
MnlI CCTC 1 cut(s) 8
MwoI GCNNNNNNNGC 1 cut(s) 143
NdeII GATC 1 cut(s) 46
PfeI GAWTC 1 cut(s) 201
PsuI RGATCY 1 cut(s) 46
RsaI GTAC 2 cut(s) 83, 100
RsaNI GTAC 2 cut(s) 82, 99
Sau3AI GATC 1 cut(s) 46
SetI ASST 4 cut(s) 63, 87, 100, 116
SfcI CTRYAG 1 cut(s) 93
SgeI CNNG 6 cut(s) 24, 56, 70, 142, 164, 219
Sse9I AATT 1 cut(s) 180
SspMI CTAG 2 cut(s) 207, 229
TasI AATT 1 cut(s) 180
TfiI GAWTC 1 cut(s) 201
TscAI CASTG 1 cut(s) 144
TspRI CASTG 1 cut(s) 144
XspI CTAG 2 cut(s) 207, 229
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.