pycom12668g00030

quinone oxidoreductase

Basic Information

Type: gene
Biological Identity
pyrus_communis
tig00012668
Physical Location & Seq
Reverse (-)
20622 .. 20981
360 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom12668g00030.1

Sequence Viewer

Length: 360 bp
ATGATTCGTCATATCAAGAATATAGAAAGATTCGGAACTTCAAAAGAAGTGAAGCTGATTCTAGTTCTTTTGGCAAAGGTTTTAATGCCATTGGTCAAAGTCAAAGTGATAGATGTATTGGTAATCCCAGATCTCAAAGACAAGGTGATTTTGGTAAAAGAAATGTACCTTTGGGCTGTAGGTACAATAATGGACACCTTTGAGAATGTAGGTGAGAAAGCATTGGACGCTTTACAAGTGGATAGATGGGACATAGAACTGCAAATTATGTCCAAAGCCAACAGAAGCCCTAGCAGTCTTCTTTGCCACAACTGGCGCCGATCCAGCAAGTTCCTGGATATATTAATTATGGTCAGTTAG

Protein Analysis

120

Amino Acids

13.72

Weight (kDa)

9.33

Isoelectric Point (pI)

62.36

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0020433)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 315
AclWI GGATC 1 cut(s) 315
AcyI GRCGYC 1 cut(s) 316
AfaI GTAC 2 cut(s) 167, 184
AgsI TTSAA 1 cut(s) 42
AjnI CCWGG 1 cut(s) 333
AluBI AGCT 1 cut(s) 55
AluI AGCT 1 cut(s) 55
AlwI GGATC 1 cut(s) 315
AseI ATTAAT 1 cut(s) 344
AspLEI GCGC 1 cut(s) 318
AsuHPI GGTGA 2 cut(s) 157, 224
BanI GGYRCC 1 cut(s) 315
BbsI GAAGAC 1 cut(s) 290
BccI CCATC 1 cut(s) 240
BciT130I CCWGG 1 cut(s) 335
BfaI CTAG 2 cut(s) 62, 291
BfmI CTRYAG 1 cut(s) 177
BfoI RGCGCY 1 cut(s) 319
BglII AGATCT 1 cut(s) 130
Bme1390I CCNGG 1 cut(s) 335
BmiI GGNNCC 1 cut(s) 317
BmrFI CCNGG 1 cut(s) 335
BpiI GAAGAC 1 cut(s) 290
BsaHI GRCGYC 1 cut(s) 316
Bse1I ACTGG 1 cut(s) 317
BseBI CCWGG 1 cut(s) 335
BseNI ACTGG 1 cut(s) 317
BshNI GGYRCC 1 cut(s) 315
BslFI GGGAC 1 cut(s) 263
BsmFI GGGAC 1 cut(s) 263
Bsp143I GATC 2 cut(s) 130, 320
BspLI GGNNCC 1 cut(s) 317
BspPI GGATC 1 cut(s) 315
BspT107I GGYRCC 1 cut(s) 315
BsrI ACTGG 1 cut(s) 317
BssMI GATC 2 cut(s) 130, 320
BssNI GRCGYC 1 cut(s) 316
Bst2UI CCWGG 1 cut(s) 335
BstACI GRCGYC 1 cut(s) 316
BstH2I RGCGCY 1 cut(s) 319
BstHHI GCGC 1 cut(s) 318
BstKTI GATC 2 cut(s) 133, 323
BstMBI GATC 2 cut(s) 130, 320
BstMWI GCNNNNNNNGC 2 cut(s) 227, 324
BstNI CCWGG 1 cut(s) 335
BstSCI CCNGG 1 cut(s) 333
BstSFI CTRYAG 1 cut(s) 177
BstV2I GAAGAC 1 cut(s) 290
BstX2I RGATCY 1 cut(s) 130
BstYI RGATCY 1 cut(s) 130
CfoI GCGC 1 cut(s) 318
CseI GACGC 1 cut(s) 236
Csp6I GTAC 2 cut(s) 166, 183
CviJI RGCY 4 cut(s) 55, 176, 278, 288
CviKI_1 RGCY 4 cut(s) 55, 176, 278, 288
CviQI GTAC 2 cut(s) 166, 183
DinI GGCGCC 1 cut(s) 317
DpnI GATC 2 cut(s) 132, 322
DpnII GATC 2 cut(s) 130, 320
EcoRII CCWGG 1 cut(s) 333
EgeI GGCGCC 1 cut(s) 317
EheI GGCGCC 1 cut(s) 317
FaiI YATR 6 cut(s) 12, 23, 254, 269, 341, 350
FaqI GGGAC 1 cut(s) 263
FspBI CTAG 2 cut(s) 62, 291
GlaI GCGC 1 cut(s) 317
HaeII RGCGCY 1 cut(s) 319
HgaI GACGC 1 cut(s) 236
HhaI GCGC 1 cut(s) 318
Hin1I GRCGYC 1 cut(s) 316
Hin6I GCGC 1 cut(s) 316
HinP1I GCGC 1 cut(s) 316
HinfI GANTC 3 cut(s) 4, 30, 58
HphI GGTGA 2 cut(s) 157, 224
Hpy188I TCNGA 1 cut(s) 35
Hpy188III TCNNGA 1 cut(s) 16
HpyCH4V TGCA 1 cut(s) 262
HpyF10VI GCNNNNNNNGC 2 cut(s) 227, 324
Hsp92I GRCGYC 1 cut(s) 316
HspAI GCGC 1 cut(s) 316
KasI GGCGCC 1 cut(s) 315
Kzo9I GATC 2 cut(s) 130, 320
LpnPI CCDG 5 cut(s) 141, 298, 320, 337, 347
MaeI CTAG 2 cut(s) 62, 291
MalI GATC 2 cut(s) 132, 322
MboI GATC 2 cut(s) 130, 320
MboII GAAGA 1 cut(s) 290
MflI RGATCY 1 cut(s) 130
MluCI AATT 2 cut(s) 264, 345
Mly113I GGCGCC 1 cut(s) 316
MseI TTAA 2 cut(s) 83, 344
MspR9I CCNGG 1 cut(s) 335
MvaI CCWGG 1 cut(s) 335
MwoI GCNNNNNNNGC 2 cut(s) 227, 324
NarI GGCGCC 1 cut(s) 316
NdeII GATC 2 cut(s) 130, 320
NlaIV GGNNCC 1 cut(s) 317
PfeI GAWTC 3 cut(s) 4, 30, 58
PfoI TCCNGGA 1 cut(s) 333
PluTI GGCGCC 1 cut(s) 319
PshBI ATTAAT 1 cut(s) 344
Psp6I CCWGG 1 cut(s) 333
PspGI CCWGG 1 cut(s) 333
PspN4I GGNNCC 1 cut(s) 317
PsuI RGATCY 1 cut(s) 130
RsaI GTAC 2 cut(s) 167, 184
RsaNI GTAC 2 cut(s) 166, 183
SaqAI TTAA 2 cut(s) 83, 344
Sau3AI GATC 2 cut(s) 130, 320
ScrFI CCNGG 1 cut(s) 335
SetI ASST 7 cut(s) 57, 81, 147, 171, 184, 200, 214
SfcI CTRYAG 1 cut(s) 177
SfoI GGCGCC 1 cut(s) 317
Sse9I AATT 2 cut(s) 264, 345
SspDI GGCGCC 1 cut(s) 315
SspMI CTAG 2 cut(s) 62, 291
StyD4I CCNGG 1 cut(s) 333
TasI AATT 2 cut(s) 264, 345
TfiI GAWTC 3 cut(s) 4, 30, 58
Tru1I TTAA 2 cut(s) 83, 344
Tru9I TTAA 2 cut(s) 83, 344
VspI ATTAAT 1 cut(s) 344
XcmI CCANNNNNNNNNTGG 1 cut(s) 331
XspI CTAG 2 cut(s) 62, 291
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.