pycom10g00010

Belongs to the oxygen-dependent FAD-linked oxidoreductase family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr10
OG0017055
Physical Location & Seq
Reverse (-)
4266 .. 4553
288 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom10g00010.1

Sequence Viewer

Length: 288 bp
ATGACAGAGTATGTTTCATGGGGTCCTAGGGCTGCTTATATCAACTATGTTGACCTCGACCTCGGACTGATGATGCGGCAGCAGTTTCCTTTAAATAATAATTTGGTTAAGGATGATGAATCTGACGCTGTGGAAATTGCCAGGAATTGGGGTGAAAAGTACTTCCTAAATAACTACGACAGATTGGTGAGAGCAAAAACACTTATTGATCCAACCAACGTTTTCAGGAATCAACAAGGGATTCCTCCGATGTCGTCATCTTCGTCTTTGGTGGTGCTCGATCATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00940 ko01100 ko01110 map00940 map01100 map01110
Pfam Domains
Protein Families
BBE FAD_binding_4

Protein Analysis

96

Amino Acids

10.97

Weight (kDa)

4.9

Isoelectric Point (pI)

29.84

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
BBE PF08031 12 - 82 5.8e-20 Berberine and berberine like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0017055)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G44380 AT5G44380
fragaria_vesca FvH4_2g00110
malus_domestica MD00G1103700.v1.1
prunus_persica Prupe.4G257400_v2.0.a1
pyrus_communis pycom10g00010
rosa_chinensis RchiOBHm_Chr6g0249371
rosa_laevigata RLG00000015586
rosa_multiflora Rmu_co8327045.1_g000001 Rmu_sc0006234.1_g000001
rosa_roxburghii Rroxscaffold_7G00217810
rosa_rugosa Rorug05G0491200
rosa_wichuraiana Rw6G000210

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 147
AciI CCGC 1 cut(s) 76
AclI AACGTT 1 cut(s) 219
AclWI GGATC 1 cut(s) 203
AfaI GTAC 1 cut(s) 161
AfiI CCNNNNNNNGG 1 cut(s) 147
AjnI CCWGG 1 cut(s) 140
Alw21I GWGCWC 1 cut(s) 279
AlwI GGATC 1 cut(s) 203
ApeKI GCWGC 2 cut(s) 32, 79
AspA2I CCTAGG 1 cut(s) 26
AspS9I GGNCC 1 cut(s) 23
AsuHPI GGTGA 2 cut(s) 164, 199
AvaII GGWCC 1 cut(s) 23
AvrII CCTAGG 1 cut(s) 26
Bbv12I GWGCWC 1 cut(s) 279
BbvI GCAGC 2 cut(s) 19, 91
BciT130I CCWGG 1 cut(s) 142
BfaI CTAG 1 cut(s) 27
BisI GCNGC 3 cut(s) 33, 77, 80
BlnI CCTAGG 1 cut(s) 26
BlsI GCNGC 3 cut(s) 34, 78, 81
BmcAI AGTACT 1 cut(s) 161
Bme1390I CCNGG 1 cut(s) 142
Bme18I GGWCC 1 cut(s) 23
BmgT120I GGNCC 1 cut(s) 23
BmiI GGNNCC 1 cut(s) 24
BmrFI CCNGG 1 cut(s) 142
BmsI GCATC 1 cut(s) 63
BsaJI CCNNGG 2 cut(s) 26, 61
Bsc4I CCNNNNNNNGG 1 cut(s) 147
BseBI CCWGG 1 cut(s) 142
BseDI CCNNGG 2 cut(s) 26, 61
BseGI GGATG 1 cut(s) 118
BseLI CCNNNNNNNGG 1 cut(s) 147
BseXI GCAGC 2 cut(s) 19, 91
BsiHKAI GWGCWC 1 cut(s) 279
BslI CCNNNNNNNGG 1 cut(s) 147
Bsp1286I GDGCHC 1 cut(s) 279
Bsp143I GATC 2 cut(s) 208, 280
BspACI CCGC 1 cut(s) 76
BspLI GGNNCC 1 cut(s) 24
BspPI GGATC 1 cut(s) 203
BssECI CCNNGG 2 cut(s) 26, 61
BssMI GATC 2 cut(s) 208, 280
BssT1I CCWWGG 1 cut(s) 26
Bst2UI CCWGG 1 cut(s) 142
BstF5I GGATG 1 cut(s) 118
BstKTI GATC 2 cut(s) 211, 283
BstMBI GATC 2 cut(s) 208, 280
BstNI CCWGG 1 cut(s) 142
BstSCI CCNGG 1 cut(s) 140
BstV1I GCAGC 2 cut(s) 19, 91
BtsCI GGATG 1 cut(s) 118
Cfr13I GGNCC 1 cut(s) 23
CseI GACGC 1 cut(s) 134
Csp6I GTAC 1 cut(s) 160
CviAII CATG 1 cut(s) 18
CviJI RGCY 1 cut(s) 32
CviKI_1 RGCY 1 cut(s) 32
CviQI GTAC 1 cut(s) 160
DpnI GATC 2 cut(s) 210, 282
DpnII GATC 2 cut(s) 208, 280
DraI TTTAAA 1 cut(s) 93
Eco130I CCWWGG 1 cut(s) 26
Eco47I GGWCC 1 cut(s) 23
EcoO109I RGGNCCY 1 cut(s) 23
EcoRII CCWGG 1 cut(s) 140
EcoT14I CCWWGG 1 cut(s) 26
ErhI CCWWGG 1 cut(s) 26
FaeI CATG 1 cut(s) 21
FaiI YATR 4 cut(s) 12, 19, 39, 48
FatI CATG 1 cut(s) 17
Fnu4HI GCNGC 3 cut(s) 33, 77, 80
FokI GGATG 1 cut(s) 125
Fsp4HI GCNGC 3 cut(s) 33, 77, 80
FspBI CTAG 1 cut(s) 27
GluI GCNGC 3 cut(s) 33, 77, 80
HgaI GACGC 1 cut(s) 134
Hin1II CATG 1 cut(s) 21
HincII GTYRAC 1 cut(s) 52
HindII GTYRAC 1 cut(s) 52
HinfI GANTC 3 cut(s) 119, 229, 241
HphI GGTGA 2 cut(s) 164, 199
Hpy166II GTNNAC 1 cut(s) 52
Hpy188I TCNGA 3 cut(s) 65, 124, 249
Hpy188III TCNNGA 1 cut(s) 226
Hpy8I GTNNAC 1 cut(s) 52
HpyCH4IV ACGT 1 cut(s) 219
HpySE526I ACGT 1 cut(s) 219
Hsp92II CATG 1 cut(s) 21
Kzo9I GATC 2 cut(s) 208, 280
LpnPI CCDG 3 cut(s) 127, 154, 211
Lsp1109I GCAGC 2 cut(s) 19, 91
LweI GCATC 1 cut(s) 63
MaeI CTAG 1 cut(s) 27
MaeII ACGT 1 cut(s) 219
MalI GATC 2 cut(s) 210, 282
MboI GATC 2 cut(s) 208, 280
MboII GAAGA 1 cut(s) 252
MhlI GDGCHC 1 cut(s) 279
MluCI AATT 3 cut(s) 100, 135, 145
MmeI TCCRAC 1 cut(s) 236
MnlI CCTC 3 cut(s) 65, 71, 255
MseI TTAA 2 cut(s) 92, 108
MspR9I CCNGG 1 cut(s) 142
MvaI CCWGG 1 cut(s) 142
NdeII GATC 2 cut(s) 208, 280
NlaIII CATG 1 cut(s) 21
NlaIV GGNNCC 1 cut(s) 24
PcsI WCGNNNNNNNCGW 1 cut(s) 260
PfeI GAWTC 3 cut(s) 119, 229, 241
PflMI CCANNNNNTGG 1 cut(s) 147
PkrI GCNGC 3 cut(s) 34, 78, 81
PpuMI RGGWCCY 1 cut(s) 23
Psp1406I AACGTT 1 cut(s) 219
Psp5II RGGWCCY 1 cut(s) 23
Psp6I CCWGG 1 cut(s) 140
PspGI CCWGG 1 cut(s) 140
PspN4I GGNNCC 1 cut(s) 24
PspPI GGNCC 1 cut(s) 23
PspPPI RGGWCCY 1 cut(s) 23
RsaI GTAC 1 cut(s) 161
RsaNI GTAC 1 cut(s) 160
SaqAI TTAA 2 cut(s) 92, 108
SatI GCNGC 3 cut(s) 33, 77, 80
Sau3AI GATC 2 cut(s) 208, 280
Sau96I GGNCC 1 cut(s) 23
ScaI AGTACT 1 cut(s) 161
ScrFI CCNGG 1 cut(s) 142
SduI GDGCHC 1 cut(s) 279
SetI ASST 3 cut(s) 57, 63, 222
SfaNI GCATC 1 cut(s) 63
SgeI CNNG 8 cut(s) 30, 39, 68, 74, 153, 154, 238, 248
SinI GGWCC 1 cut(s) 23
Sse9I AATT 3 cut(s) 100, 135, 145
SsiI CCGC 1 cut(s) 76
SspMI CTAG 1 cut(s) 27
StyD4I CCNGG 1 cut(s) 140
StyI CCWWGG 1 cut(s) 26
TaiI ACGT 1 cut(s) 222
TaqI TCGA 2 cut(s) 57, 279
TasI AATT 3 cut(s) 100, 135, 145
TatI WGTACW 1 cut(s) 159
TauI GCSGC 1 cut(s) 79
TfiI GAWTC 3 cut(s) 119, 229, 241
Tru1I TTAA 2 cut(s) 92, 108
Tru9I TTAA 2 cut(s) 92, 108
TseI GCWGC 2 cut(s) 32, 79
TspDTI ATGAA 2 cut(s) 6, 132
Van91I CCANNNNNTGG 1 cut(s) 147
VpaK11BI GGWCC 1 cut(s) 23
XmaJI CCTAGG 1 cut(s) 26
XspI CTAG 1 cut(s) 27
ZrmI AGTACT 1 cut(s) 161
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.