Rmu_co8327045.1_g000001

Belongs to the oxygen-dependent FAD-linked oxidoreductase family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8327045.1
Physical Location & Seq
Forward (+)
1 .. 964
964 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8327045.1_g000001.1.cds

Sequence Viewer

Length: 964 bp
actacattccccaacacagaaaatgactctgcttcttacttcaagttgctcaacttttctattcagaatctacgttttgctgagcccacagttcctaagccaatagccattatactccctgagagtgttgagcagataataaactctgtattctgctctagagaagtgttcttggcaatcagagtgaggtgtggtggacacagctatgaagggacatcatctgttgctgctgatggagctccatttgtgatcattgacatgatgaatttgaacagggtttctgtggatttggaaaccgaaatggcatgggtggaaggaggtgcaacactaggtgagacgtaccatgcaattgccaaagcaagcagtgttcacggtttctcagctgggtcatgcccaactgttggtgccagtggccatattgctggcggtggatttggactactttcaaggaaatatggacttgcagctgataatgtggcggatgcacttcttgttgatgctgacggacggttgttagaccgacaaggcatgggagaggatgtgttttgggctattagaggaggtggtgggggtgtttgggggattgtctatgcatggaaaatccaactgtccaaagtgccacaaaaagttacagtttttctggcgtctagagcaggaaacaaaagccatatagcaaatctagtagacaagtggcaacatgttgcacctttcttagaagatgacttctatatttcctgttttgttggtgctgggttgccagaagccaagaccagtggtattactgggatgtcagcgacatttaaagggttttatctgggtccaagaagcagtgctatgtccaccctagatcaggttttccctgacttgggtattgtaaaagaagattgcaaggaaatgagttggatcgagtcgattgtattcttctccggcctaggtaatggaagtgccatctccgacttgagaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

321

Amino Acids

34.28

Weight (kDa)

5.28

Isoelectric Point (pI)

34.87

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017055)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G44380 AT5G44380
fragaria_vesca FvH4_2g00110
malus_domestica MD00G1103700.v1.1
prunus_persica Prupe.4G257400_v2.0.a1
pyrus_communis pycom10g00010
rosa_chinensis RchiOBHm_Chr6g0249371
rosa_laevigata RLG00000015586
rosa_multiflora Rmu_co8327045.1_g000001 Rmu_sc0006234.1_g000001
rosa_roxburghii Rroxscaffold_7G00217810
rosa_rugosa Rorug05G0491200
rosa_wichuraiana Rw6G000210

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 404
AccB7I CCANNNNNTGG 1 cut(s) 401
AccI GTMKAC 1 cut(s) 684
AciI CCGC 2 cut(s) 426, 479
AclWI GGATC 1 cut(s) 911
AcoI YGGCCR 1 cut(s) 412
AcsI RAATTY 1 cut(s) 265
AcyI GRCGYC 1 cut(s) 644
AdeI CACNNNGTG 1 cut(s) 332
AfaI GTAC 1 cut(s) 341
AfiI CCNNNNNNNGG 4 cut(s) 401, 850, 865, 866
AflIII ACRYGT 1 cut(s) 697
AgsI TTSAA 3 cut(s) 43, 271, 447
AluBI AGCT 4 cut(s) 204, 239, 383, 467
AluI AGCT 4 cut(s) 204, 239, 383, 467
Alw21I GWGCWC 1 cut(s) 241
Alw26I GTCTC 1 cut(s) 329
AlwI GGATC 1 cut(s) 911
AoxI GGCC 2 cut(s) 412, 928
ApeKI GCWGC 2 cut(s) 227, 464
ApoI RAATTY 1 cut(s) 265
AspA2I CCTAGG 1 cut(s) 931
AspS9I GGNCC 1 cut(s) 818
AsuHPI GGTGA 1 cut(s) 344
AvaII GGWCC 1 cut(s) 818
AvrII CCTAGG 1 cut(s) 931
BalI TGGCCA 1 cut(s) 414
BanI GGYRCC 1 cut(s) 404
BanII GRGCYC 2 cut(s) 87, 241
Bbv12I GWGCWC 1 cut(s) 241
BbvI GCAGC 2 cut(s) 214, 476
BccI CCATC 2 cut(s) 227, 956
BclI TGATCA 1 cut(s) 249
BcoDI GTCTC 1 cut(s) 329
BfaI CTAG 6 cut(s) 159, 329, 648, 680, 845, 932
BisI GCNGC 2 cut(s) 228, 465
BlnI CCTAGG 1 cut(s) 931
BlpI GCTNAGC 1 cut(s) 81
BlsI GCNGC 2 cut(s) 229, 466
Bme18I GGWCC 1 cut(s) 818
BmgT120I GGNCC 1 cut(s) 818
BmiI GGNNCC 2 cut(s) 406, 819
BmrI ACTGGG 1 cut(s) 792
BmsI GCATC 2 cut(s) 472, 487
BmuI ACTGGG 1 cut(s) 792
Bpu10I CCTNAGC 1 cut(s) 96
Bpu1102I GCTNAGC 1 cut(s) 81
BsaHI GRCGYC 1 cut(s) 644
BsaJI CCNNGG 1 cut(s) 931
BsaXI ACNNNNNCTCC 2 cut(s) 525, 555
Bsc4I CCNNNNNNNGG 4 cut(s) 401, 850, 865, 866
Bse1I ACTGG 3 cut(s) 408, 771, 787
BseDI CCNNGG 1 cut(s) 931
BseGI GGATG 3 cut(s) 487, 544, 792
BseLI CCNNNNNNNGG 4 cut(s) 401, 850, 865, 866
BseMII CTCAG 3 cut(s) 72, 111, 393
BseNI ACTGG 3 cut(s) 408, 771, 787
BseRI GAGGAG 1 cut(s) 573
BseXI GCAGC 2 cut(s) 214, 476
BseYI CCCAGC 2 cut(s) 383, 749
BshFI GGCC 2 cut(s) 414, 930
BshNI GGYRCC 1 cut(s) 404
BsiHKAI GWGCWC 1 cut(s) 241
BsiSI CCGG 1 cut(s) 927
BslFI GGGAC 1 cut(s) 226
BslI CCNNNNNNNGG 4 cut(s) 401, 850, 865, 866
BsmAI GTCTC 1 cut(s) 329
BsmBI CGTCTC 1 cut(s) 329
BsmFI GGGAC 1 cut(s) 226
BsnI GGCC 2 cut(s) 414, 930
Bsp1286I GDGCHC 2 cut(s) 87, 241
Bsp143I GATC 3 cut(s) 249, 847, 903
Bsp1720I GCTNAGC 1 cut(s) 81
BspACI CCGC 2 cut(s) 426, 479
BspANI GGCC 2 cut(s) 414, 930
BspCNI CTCAG 3 cut(s) 73, 112, 392
BspLI GGNNCC 2 cut(s) 406, 819
BspPI GGATC 1 cut(s) 911
BspT107I GGYRCC 1 cut(s) 404
BsrI ACTGG 3 cut(s) 408, 771, 787
BssECI CCNNGG 1 cut(s) 931
BssMI GATC 3 cut(s) 249, 847, 903
BssNI GRCGYC 1 cut(s) 644
BssT1I CCWWGG 1 cut(s) 931
Bst4CI ACNGT 6 cut(s) 91, 374, 400, 510, 609, 634
BstACI GRCGYC 1 cut(s) 644
BstC8I GCNNGC 2 cut(s) 361, 424
BstDEI CTNAG 5 cut(s) 81, 96, 120, 379, 712
BstENI CCTNNNNNAGG 1 cut(s) 848
BstF5I GGATG 3 cut(s) 487, 544, 792
BstKTI GATC 3 cut(s) 252, 850, 906
BstMAI GTCTC 1 cut(s) 329
BstMBI GATC 3 cut(s) 249, 847, 903
BstMWI GCNNNNNNNGC 2 cut(s) 236, 650
BstNSI RCATGY 1 cut(s) 701
BstV1I GCAGC 2 cut(s) 214, 476
BstXI CCANNNNNNTGG 1 cut(s) 422
BsuRI GGCC 2 cut(s) 414, 930
BtsCI GGATG 3 cut(s) 487, 544, 792
BtsI GCAGTG 2 cut(s) 370, 835
BtsIMutI CAGTG 4 cut(s) 370, 415, 778, 835
Cac8I GCNNGC 2 cut(s) 361, 424
Cfr13I GGNCC 1 cut(s) 818
CseI GACGC 1 cut(s) 633
Csp6I GTAC 1 cut(s) 340
CspCI CAANNNNNGTGG 2 cut(s) 754, 789
CviAII CATG 7 cut(s) 259, 306, 344, 390, 529, 594, 698
CviQI GTAC 1 cut(s) 340
DdeI CTNAG 5 cut(s) 81, 96, 120, 379, 712
DpnI GATC 3 cut(s) 251, 849, 905
DpnII GATC 3 cut(s) 249, 847, 903
DraI TTTAAA 1 cut(s) 802
DraIII CACNNNGTG 1 cut(s) 332
EaeI YGGCCR 1 cut(s) 412
EciI GGCGGA 1 cut(s) 494
Ecl136II GAGCTC 1 cut(s) 239
Eco130I CCWWGG 1 cut(s) 931
Eco24I GRGCYC 2 cut(s) 87, 241
Eco47I GGWCC 1 cut(s) 818
Eco53kI GAGCTC 1 cut(s) 239
EcoICRI GAGCTC 1 cut(s) 239
EcoNI CCTNNNNNAGG 1 cut(s) 848
EcoT14I CCWWGG 1 cut(s) 931
EcoT22I ATGCAT 1 cut(s) 595
EcoT38I GRGCYC 2 cut(s) 87, 241
ErhI CCWWGG 1 cut(s) 931
Esp3I CGTCTC 1 cut(s) 329
FaeI CATG 7 cut(s) 262, 309, 347, 393, 532, 597, 701
FaqI GGGAC 1 cut(s) 226
FatI CATG 7 cut(s) 258, 305, 343, 389, 528, 593, 697
FbaI TGATCA 1 cut(s) 249
FblI GTMKAC 1 cut(s) 684
Fnu4HI GCNGC 2 cut(s) 228, 465
FokI GGATG 3 cut(s) 494, 551, 799
FriOI GRGCYC 2 cut(s) 87, 241
Fsp4HI GCNGC 2 cut(s) 228, 465
FspBI CTAG 6 cut(s) 159, 329, 648, 680, 845, 932
GluI GCNGC 2 cut(s) 228, 465
GsaI CCCAGC 2 cut(s) 387, 753
HaeIII GGCC 2 cut(s) 414, 930
HapII CCGG 1 cut(s) 927
HgaI GACGC 1 cut(s) 633
Hin1I GRCGYC 1 cut(s) 644
Hin1II CATG 7 cut(s) 262, 309, 347, 393, 532, 597, 701
HinfI GANTC 3 cut(s) 26, 67, 908
HpaII CCGG 1 cut(s) 927
HphI GGTGA 1 cut(s) 344
Hpy166II GTNNAC 4 cut(s) 197, 370, 685, 840
Hpy188I TCNGA 3 cut(s) 66, 182, 955
Hpy188III TCNNGA 2 cut(s) 159, 648
Hpy8I GTNNAC 4 cut(s) 197, 370, 685, 840
HpyAV CCTTC 2 cut(s) 203, 308
HpyCH4III ACNGT 6 cut(s) 91, 374, 400, 510, 609, 634
HpyCH4IV ACGT 2 cut(s) 73, 338
HpyCH4V TGCA 7 cut(s) 323, 347, 464, 485, 593, 704, 888
HpyF10VI GCNNNNNNNGC 2 cut(s) 236, 650
HpyF3I CTNAG 5 cut(s) 81, 96, 120, 379, 712
HpySE526I ACGT 2 cut(s) 73, 338
Hsp92I GRCGYC 1 cut(s) 644
Hsp92II CATG 7 cut(s) 262, 309, 347, 393, 532, 597, 701
Ksp22I TGATCA 1 cut(s) 249
Kzo9I GATC 3 cut(s) 249, 847, 903
LmnI GCTCC 2 cut(s) 236, 244
Lsp1109I GCAGC 2 cut(s) 214, 476
LweI GCATC 2 cut(s) 472, 487
MaeI CTAG 6 cut(s) 159, 329, 648, 680, 845, 932
MaeII ACGT 2 cut(s) 73, 338
MaeIII GTNAC 1 cut(s) 628
MalI GATC 3 cut(s) 251, 849, 905
MboI GATC 3 cut(s) 249, 847, 903
MboII GAAGA 3 cut(s) 728, 893, 913
MfeI CAATTG 1 cut(s) 348
MhlI GDGCHC 2 cut(s) 87, 241
MlsI TGGCCA 1 cut(s) 414
MluCI AATT 2 cut(s) 265, 348
MluNI TGGCCA 1 cut(s) 414
MlyI GAGTC 2 cut(s) 20, 917
MmeI TCCRAC 2 cut(s) 628, 881
MnlI CCTC 5 cut(s) 180, 311, 529, 551, 554
Mox20I TGGCCA 1 cut(s) 414
Mph1103I ATGCAT 1 cut(s) 595
MscI TGGCCA 1 cut(s) 414
MseI TTAA 1 cut(s) 801
MslI CAYNNNNRTG 2 cut(s) 204, 257
Msp20I TGGCCA 1 cut(s) 414
MspA1I CMGCKG 2 cut(s) 383, 467
MspI CCGG 1 cut(s) 927
MunI CAATTG 1 cut(s) 348
MwoI GCNNNNNNNGC 2 cut(s) 236, 650
NdeII GATC 3 cut(s) 249, 847, 903
NlaIII CATG 7 cut(s) 262, 309, 347, 393, 532, 597, 701
NlaIV GGNNCC 2 cut(s) 406, 819
NsiI ATGCAT 1 cut(s) 595
NspI RCATGY 1 cut(s) 701
PciI ACATGT 1 cut(s) 697
PfeI GAWTC 1 cut(s) 67
PflMI CCANNNNNTGG 1 cut(s) 401
PkrI GCNGC 2 cut(s) 229, 466
PleI GAGTC 2 cut(s) 20, 916
PpsI GAGTC 2 cut(s) 20, 916
PscI ACATGT 1 cut(s) 697
Psp124BI GAGCTC 1 cut(s) 241
PspFI CCCAGC 2 cut(s) 383, 749
PspN4I GGNNCC 2 cut(s) 406, 819
PspPI GGNCC 1 cut(s) 818
PvuII CAGCTG 2 cut(s) 383, 467
RsaI GTAC 1 cut(s) 341
RsaNI GTAC 1 cut(s) 340
RseI CAYNNNNRTG 2 cut(s) 204, 257
SacI GAGCTC 1 cut(s) 241
SaqAI TTAA 1 cut(s) 801
SatI GCNGC 2 cut(s) 228, 465
Sau3AI GATC 3 cut(s) 249, 847, 903
Sau96I GGNCC 1 cut(s) 818
SchI GAGTC 2 cut(s) 20, 917
SduI GDGCHC 2 cut(s) 87, 241
SfaNI GCATC 2 cut(s) 472, 487
SinI GGWCC 1 cut(s) 818
SmiMI CAYNNNNRTG 2 cut(s) 204, 257
SmlI CTYRAG 1 cut(s) 958
SmoI CTYRAG 1 cut(s) 958
Sse9I AATT 2 cut(s) 265, 348
SsiI CCGC 2 cut(s) 426, 479
SspMI CTAG 6 cut(s) 159, 329, 648, 680, 845, 932
SstI GAGCTC 1 cut(s) 241
StyI CCWWGG 1 cut(s) 931
TaaI ACNGT 6 cut(s) 91, 374, 400, 510, 609, 634
TaiI ACGT 2 cut(s) 76, 341
TaqI TCGA 2 cut(s) 906, 911
TaqII GACCGA 1 cut(s) 534
TasI AATT 2 cut(s) 265, 348
TfiI GAWTC 1 cut(s) 67
Tru1I TTAA 1 cut(s) 801
Tru9I TTAA 1 cut(s) 801
TscAI CASTG 4 cut(s) 370, 415, 778, 835
TseI GCWGC 2 cut(s) 227, 464
TspDTI ATGAA 2 cut(s) 222, 278
TspGWI ACGGA 1 cut(s) 519
TspRI CASTG 4 cut(s) 370, 415, 778, 835
Van91I CCANNNNNTGG 1 cut(s) 401
VpaK11BI GGWCC 1 cut(s) 818
XagI CCTNNNNNAGG 1 cut(s) 848
XapI RAATTY 1 cut(s) 265
XbaI TCTAGA 2 cut(s) 158, 647
XceI RCATGY 1 cut(s) 701
XmaJI CCTAGG 1 cut(s) 931
XmiI GTMKAC 1 cut(s) 684
XspI CTAG 6 cut(s) 159, 329, 648, 680, 845, 932
Zsp2I ATGCAT 1 cut(s) 595
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.