pycom11g01640

Selenoprotein

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr11
Physical Location & Seq
Forward (+)
1418922 .. 1419813
892 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom11g01640.1

Sequence Viewer

Length: 363 bp
ATGGAACTGTGCCAAAGCTGTTTTTCTGAACTTTGCTCCCATCATGATTTTTTAACAGCTTGGGTGGTGGAGGTTGCTGAGAGTACTGCTTCCTTGGTTGCCAGATGGCAGGGGGTTGGTTTTACTCATGATGTGTTGAACACTGACATTATGAGCATTTTGGGTCTTACCATCGATTATGGTCCATTTGGACTTCTGGATGTATTTGATCCAAGTTACACGCCAAATACCACGGATCTTCCTGGGAGGAGATATTGTTTTGCAAATCAGCCTGATATTGGGTTGTGGAATATTGCACAATTCACCAGAACTCTTGTAGCTGTCAAGTTGATAGATGATATGGAGGTGAATTATGCAGTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

121

Amino Acids

13.42

Weight (kDa)

4.26

Isoelectric Point (pI)

41.44

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
SelO PF02696 7 - 116 3.3e-34 Protein adenylyltransferase SelO
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0022550)

Species Orthologous Gene IDs
pyrus_communis pycom11g01640 pycom11g01660
rosa_chinensis RchiOBHm_Chr5g0079011 RchiOBHm_Chr5g0079021

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 203, 243
AfaI GTAC 1 cut(s) 85
AfiI CCNNNNNNNGG 1 cut(s) 278
AgsI TTSAA 1 cut(s) 139
AjnI CCWGG 1 cut(s) 241
AluBI AGCT 3 cut(s) 18, 59, 320
AluI AGCT 3 cut(s) 18, 59, 320
AlwI GGATC 2 cut(s) 203, 243
AspS9I GGNCC 1 cut(s) 182
AsuHPI GGTGA 2 cut(s) 295, 358
AvaII GGWCC 1 cut(s) 182
BccI CCATC 3 cut(s) 48, 99, 179
BciT130I CCWGG 1 cut(s) 243
BmcAI AGTACT 1 cut(s) 85
Bme1390I CCNGG 1 cut(s) 243
Bme18I GGWCC 1 cut(s) 182
BmgT120I GGNCC 1 cut(s) 182
BmrFI CCNGG 1 cut(s) 243
Bsa29I ATCGAT 1 cut(s) 174
BsaJI CCNNGG 3 cut(s) 93, 231, 242
BsaXI ACNNNNNCTCC 2 cut(s) 241, 271
Bsc4I CCNNNNNNNGG 1 cut(s) 278
BseBI CCWGG 1 cut(s) 243
BseCI ATCGAT 1 cut(s) 174
BseDI CCNNGG 3 cut(s) 93, 231, 242
BseGI GGATG 1 cut(s) 205
BseLI CCNNNNNNNGG 1 cut(s) 278
BseMII CTCAG 1 cut(s) 69
BseRI GAGGAG 1 cut(s) 262
BshVI ATCGAT 1 cut(s) 174
BslI CCNNNNNNNGG 1 cut(s) 278
Bsp143I GATC 2 cut(s) 208, 235
BspCNI CTCAG 1 cut(s) 70
BspDI ATCGAT 1 cut(s) 174
BspHI TCATGA 2 cut(s) 43, 127
BspPI GGATC 2 cut(s) 203, 243
BssECI CCNNGG 3 cut(s) 93, 231, 242
BssMI GATC 2 cut(s) 208, 235
BssT1I CCWWGG 1 cut(s) 93
Bst2UI CCWGG 1 cut(s) 243
Bst4CI ACNGT 1 cut(s) 9
BstDEI CTNAG 1 cut(s) 78
BstDSI CCRYGG 1 cut(s) 231
BstF5I GGATG 1 cut(s) 205
BstKTI GATC 2 cut(s) 211, 238
BstMBI GATC 2 cut(s) 208, 235
BstNI CCWGG 1 cut(s) 243
BstSCI CCNGG 1 cut(s) 241
BstX2I RGATCY 1 cut(s) 235
BstYI RGATCY 1 cut(s) 235
Bsu15I ATCGAT 1 cut(s) 174
BsuTUI ATCGAT 1 cut(s) 174
BtgI CCRYGG 1 cut(s) 231
BtsCI GGATG 1 cut(s) 205
BtsI GCAGTG 1 cut(s) 363
BtsIMutI CAGTG 2 cut(s) 141, 363
CciI TCATGA 2 cut(s) 43, 127
Cfr13I GGNCC 1 cut(s) 182
ClaI ATCGAT 1 cut(s) 174
Csp6I GTAC 1 cut(s) 84
CviAII CATG 2 cut(s) 44, 128
CviJI RGCY 4 cut(s) 18, 59, 271, 320
CviKI_1 RGCY 4 cut(s) 18, 59, 271, 320
CviQI GTAC 1 cut(s) 84
DdeI CTNAG 1 cut(s) 78
DpnI GATC 2 cut(s) 210, 237
DpnII GATC 2 cut(s) 208, 235
Eco130I CCWWGG 1 cut(s) 93
Eco47I GGWCC 1 cut(s) 182
EcoRII CCWGG 1 cut(s) 241
EcoT14I CCWWGG 1 cut(s) 93
ErhI CCWWGG 1 cut(s) 93
FaeI CATG 2 cut(s) 47, 131
FaiI YATR 6 cut(s) 45, 129, 152, 180, 341, 354
FatI CATG 2 cut(s) 43, 127
FokI GGATG 1 cut(s) 212
Hin1II CATG 2 cut(s) 47, 131
HphI GGTGA 2 cut(s) 295, 358
Hpy188I TCNGA 1 cut(s) 28
Hpy188III TCNNGA 3 cut(s) 44, 128, 197
HpyCH4III ACNGT 1 cut(s) 9
HpyCH4V TGCA 3 cut(s) 263, 296, 356
HpyF3I CTNAG 1 cut(s) 78
Hsp92II CATG 2 cut(s) 47, 131
Kzo9I GATC 2 cut(s) 208, 235
LmnI GCTCC 1 cut(s) 41
LpnPI CCDG 7 cut(s) 95, 115, 182, 228, 255, 285, 319
MaeIII GTNAC 1 cut(s) 215
MalI GATC 2 cut(s) 210, 237
MboI GATC 2 cut(s) 208, 235
MboII GAAGA 1 cut(s) 230
MflI RGATCY 1 cut(s) 235
MluCI AATT 2 cut(s) 299, 349
MnlI CCTC 3 cut(s) 64, 240, 337
MseI TTAA 1 cut(s) 53
MspR9I CCNGG 1 cut(s) 243
MvaI CCWGG 1 cut(s) 243
NdeII GATC 2 cut(s) 208, 235
NlaIII CATG 2 cut(s) 47, 131
PagI TCATGA 2 cut(s) 43, 127
Psp6I CCWGG 1 cut(s) 241
PspGI CCWGG 1 cut(s) 241
PspPI GGNCC 1 cut(s) 182
PsuI RGATCY 1 cut(s) 235
RsaI GTAC 1 cut(s) 85
RsaNI GTAC 1 cut(s) 84
SaqAI TTAA 1 cut(s) 53
Sau3AI GATC 2 cut(s) 208, 235
Sau96I GGNCC 1 cut(s) 182
ScaI AGTACT 1 cut(s) 85
ScrFI CCNGG 1 cut(s) 243
SetI ASST 5 cut(s) 20, 61, 75, 322, 348
SinI GGWCC 1 cut(s) 182
Sse9I AATT 2 cut(s) 299, 349
SspI AATATT 1 cut(s) 292
StyD4I CCNGG 1 cut(s) 241
StyI CCWWGG 1 cut(s) 93
TaaI ACNGT 1 cut(s) 9
TaqI TCGA 1 cut(s) 174
TasI AATT 2 cut(s) 299, 349
TatI WGTACW 1 cut(s) 83
Tru1I TTAA 1 cut(s) 53
Tru9I TTAA 1 cut(s) 53
TscAI CASTG 2 cut(s) 148, 363
TspGWI ACGGA 1 cut(s) 248
TspRI CASTG 2 cut(s) 148, 363
VpaK11BI GGWCC 1 cut(s) 182
ZrmI AGTACT 1 cut(s) 85
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.