pycom11g08490

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr11
Physical Location & Seq
Forward (+)
6591590 .. 6591910
321 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom11g08490.1

Sequence Viewer

Length: 321 bp
ATGCATGGAAATAGGGAAGCATCACGTAATAATGAACCCTTCCTTGATTTAGCATTTGGAGATGTTGAAATAGACTACGAATATTCTGATGGCTTTAGAAGTGGTTCTAGCTCAGCGTCTGAAGGTGAACAACCAGTGAAGCGGAAAAGTAAGAAGAAAATGCCCAAACTCATTCCTTTTAGAAGTGATTTGGATATGAAGAACCCACAATTTAGAACTGGAATGATATTTGCCAATAGAAAGGAGTTCAGACAAGCAGTGACATATTATGGTTGTGTGAATGGAAGACAAAATAAGATTCCCAATAAGAGAGCATTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

107

Amino Acids

12.2

Weight (kDa)

9.76

Isoelectric Point (pI)

58.07

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018849)

Species Orthologous Gene IDs
fragaria_vesca FvH4_5g25325 FvH4_5g39730 FvH4_5g39730 FvH4_5g39730 FvH4_6g08192
pyrus_communis pycom11g08490
rosa_laevigata RLG00000012064
rosa_samantha Rh3BG237500
rosa_wichuraiana Rw5G032830

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 319
AciI CCGC 1 cut(s) 142
AcuI CTGAAG 1 cut(s) 141
AgsI TTSAA 1 cut(s) 68
AluBI AGCT 1 cut(s) 111
AluI AGCT 1 cut(s) 111
AlwNI CAGNNNCTG 1 cut(s) 119
Asp700I GAANNNNTTC 1 cut(s) 103
AsuHPI GGTGA 1 cut(s) 137
BbsI GAAGAC 1 cut(s) 292
BccI CCATC 1 cut(s) 83
BfaI CTAG 1 cut(s) 108
BlpI GCTNAGC 1 cut(s) 112
BmsI GCATC 1 cut(s) 29
BpiI GAAGAC 1 cut(s) 292
Bpu1102I GCTNAGC 1 cut(s) 112
BsaAI YACGTR 1 cut(s) 26
Bse1I ACTGG 2 cut(s) 134, 223
BseMII CTCAG 1 cut(s) 126
BseNI ACTGG 2 cut(s) 134, 223
Bsp1720I GCTNAGC 1 cut(s) 112
BspACI CCGC 1 cut(s) 142
BspCNI CTCAG 1 cut(s) 125
BsrI ACTGG 2 cut(s) 134, 223
BstBAI YACGTR 1 cut(s) 26
BstDEI CTNAG 1 cut(s) 112
BstV2I GAAGAC 1 cut(s) 292
BtsI GCAGTG 1 cut(s) 264
BtsIMutI CAGTG 2 cut(s) 141, 264
CaiI CAGNNNCTG 1 cut(s) 119
CseI GACGC 1 cut(s) 105
CviAII CATG 1 cut(s) 5
CviJI RGCY 2 cut(s) 93, 111
CviKI_1 RGCY 2 cut(s) 93, 111
DdeI CTNAG 1 cut(s) 112
Eco57I CTGAAG 1 cut(s) 141
EcoT22I ATGCAT 1 cut(s) 6
FaeI CATG 1 cut(s) 8
FaiI YATR 5 cut(s) 6, 197, 265, 270, 319
FatI CATG 1 cut(s) 4
FspBI CTAG 1 cut(s) 108
HgaI GACGC 1 cut(s) 105
Hin1II CATG 1 cut(s) 8
HinfI GANTC 1 cut(s) 298
HphI GGTGA 1 cut(s) 137
Hpy166II GTNNAC 1 cut(s) 128
Hpy188I TCNGA 3 cut(s) 88, 121, 251
Hpy8I GTNNAC 1 cut(s) 128
HpyAV CCTTC 2 cut(s) 49, 116
HpyCH4IV ACGT 1 cut(s) 25
HpyCH4V TGCA 1 cut(s) 4
HpyF3I CTNAG 1 cut(s) 112
HpySE526I ACGT 1 cut(s) 25
Hsp92II CATG 1 cut(s) 8
LpnPI CCDG 2 cut(s) 147, 204
LweI GCATC 1 cut(s) 29
MaeI CTAG 1 cut(s) 108
MaeII ACGT 1 cut(s) 25
MaeIII GTNAC 1 cut(s) 259
MboII GAAGA 3 cut(s) 166, 211, 297
MluCI AATT 1 cut(s) 209
Mph1103I ATGCAT 1 cut(s) 6
MroXI GAANNNNTTC 1 cut(s) 103
NlaIII CATG 1 cut(s) 8
NmuCI GTSAC 1 cut(s) 259
NsiI ATGCAT 1 cut(s) 6
PdmI GAANNNNTTC 1 cut(s) 103
PfeI GAWTC 1 cut(s) 298
Ppu21I YACGTR 1 cut(s) 26
PsiI TTATAA 1 cut(s) 319
PstNI CAGNNNCTG 1 cut(s) 119
SetI ASST 3 cut(s) 28, 113, 127
SfaNI GCATC 1 cut(s) 29
SgeI CNNG 7 cut(s) 17, 36, 56, 120, 146, 231, 266
Sse9I AATT 1 cut(s) 209
SsiI CCGC 1 cut(s) 142
SspI AATATT 1 cut(s) 83
SspMI CTAG 1 cut(s) 108
TaiI ACGT 1 cut(s) 28
TasI AATT 1 cut(s) 209
TfiI GAWTC 1 cut(s) 298
TscAI CASTG 2 cut(s) 141, 264
TseFI GTSAC 1 cut(s) 259
Tsp45I GTSAC 1 cut(s) 259
TspDTI ATGAA 2 cut(s) 48, 212
TspRI CASTG 2 cut(s) 141, 264
XmnI GAANNNNTTC 1 cut(s) 103
XspI CTAG 1 cut(s) 108
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.