Rh3BG237500

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3B
Physical Location & Seq
Forward (+)
22263974 .. 22264234
261 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3BG237500.1

Sequence Viewer

Length: 261 bp
ATGGTTGTCTTGAAGACAATGAAGTTGATGATCCAAAAGATGAGGACTTTTGTTGATGATGATTATGAGAAAACTCAACAAAGTAATGGAGAAGGTTTCAGGGAATATAAGAAGTCAATTGTATTAGAAACTCTACAAGACTACTGGTTAGAACCAGGTGAAGAATCGTCGGAATATGATAACATCGATGATTTTGAAAGTTGTGAAAGCTCTTCAATGGATGATGATGATGAGGCTACCTACAAGCAACAACTACCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

86

Amino Acids

10.17

Weight (kDa)

4.1

Isoelectric Point (pI)

57.59

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018849)

Species Orthologous Gene IDs
fragaria_vesca FvH4_5g25325 FvH4_5g39730 FvH4_5g39730 FvH4_5g39730 FvH4_6g08192
pyrus_communis pycom11g08490
rosa_laevigata RLG00000012064
rosa_samantha Rh3BG237500
rosa_wichuraiana Rw5G032830

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 25
AgsI TTSAA 3 cut(s) 13, 197, 216
AjnI CCWGG 1 cut(s) 154
AluBI AGCT 1 cut(s) 210
AluI AGCT 1 cut(s) 210
AlwI GGATC 1 cut(s) 25
AsuHPI GGTGA 1 cut(s) 170
BbsI GAAGAC 1 cut(s) 20
BciT130I CCWGG 1 cut(s) 156
Bme1390I CCNGG 1 cut(s) 156
BmrFI CCNGG 1 cut(s) 156
BpiI GAAGAC 1 cut(s) 20
Bsa29I ATCGAT 1 cut(s) 186
Bse1I ACTGG 1 cut(s) 149
BseBI CCWGG 1 cut(s) 156
BseCI ATCGAT 1 cut(s) 186
BseGI GGATG 1 cut(s) 226
BseNI ACTGG 1 cut(s) 149
BshVI ATCGAT 1 cut(s) 186
Bsp143I GATC 1 cut(s) 30
BspDI ATCGAT 1 cut(s) 186
BspPI GGATC 1 cut(s) 25
BspQI GCTCTTC 1 cut(s) 217
BsrI ACTGG 1 cut(s) 149
BssMI GATC 1 cut(s) 30
Bst2UI CCWGG 1 cut(s) 156
Bst6I CTCTTC 1 cut(s) 217
BstF5I GGATG 1 cut(s) 226
BstKTI GATC 1 cut(s) 33
BstMBI GATC 1 cut(s) 30
BstNI CCWGG 1 cut(s) 156
BstSCI CCNGG 1 cut(s) 154
BstV2I GAAGAC 1 cut(s) 20
Bsu15I ATCGAT 1 cut(s) 186
BsuTUI ATCGAT 1 cut(s) 186
BtsCI GGATG 1 cut(s) 226
ClaI ATCGAT 1 cut(s) 186
CsiI ACCWGGT 1 cut(s) 154
CviJI RGCY 2 cut(s) 210, 236
CviKI_1 RGCY 2 cut(s) 210, 236
DpnI GATC 1 cut(s) 32
DpnII GATC 1 cut(s) 30
Eam1104I CTCTTC 1 cut(s) 217
EarI CTCTTC 1 cut(s) 217
EcoRII CCWGG 1 cut(s) 154
FaiI YATR 4 cut(s) 66, 108, 177, 259
FokI GGATG 1 cut(s) 233
HinfI GANTC 1 cut(s) 164
HphI GGTGA 1 cut(s) 170
Hpy188I TCNGA 1 cut(s) 172
Hpy188III TCNNGA 1 cut(s) 10
Hpy99I CGWCG 1 cut(s) 172
HpyAV CCTTC 1 cut(s) 86
Kzo9I GATC 1 cut(s) 30
LguI GCTCTTC 1 cut(s) 217
LpnPI CCDG 4 cut(s) 85, 130, 141, 168
MabI ACCWGGT 1 cut(s) 154
MalI GATC 1 cut(s) 32
MboI GATC 1 cut(s) 30
MboII GAAGA 3 cut(s) 25, 173, 204
MfeI CAATTG 1 cut(s) 117
MluCI AATT 1 cut(s) 117
MmeI TCCRAC 1 cut(s) 150
MnlI CCTC 2 cut(s) 36, 226
MspR9I CCNGG 1 cut(s) 156
MunI CAATTG 1 cut(s) 117
MvaI CCWGG 1 cut(s) 156
NdeII GATC 1 cut(s) 30
PciSI GCTCTTC 1 cut(s) 217
PfeI GAWTC 1 cut(s) 164
Psp6I CCWGG 1 cut(s) 154
PspGI CCWGG 1 cut(s) 154
SapI GCTCTTC 1 cut(s) 217
Sau3AI GATC 1 cut(s) 30
ScrFI CCNGG 1 cut(s) 156
SetI ASST 4 cut(s) 97, 160, 212, 242
SexAI ACCWGGT 1 cut(s) 154
SgeI CNNG 7 cut(s) 22, 112, 149, 157, 167, 168, 256
Sse9I AATT 1 cut(s) 117
StyD4I CCNGG 1 cut(s) 154
TaqI TCGA 1 cut(s) 186
TasI AATT 1 cut(s) 117
TfiI GAWTC 1 cut(s) 164
TspDTI ATGAA 1 cut(s) 35
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.