pycom11g12410

2S seed storage protein 5-like

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr11
Physical Location & Seq
Forward (+)
11316872 .. 11317478
607 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom11g12410.6

Sequence Viewer

Length: 354 bp
ATGCGTCTAGGAACTTGGAATATAGGAACTTTAATGGGCAAAATCTATGGAAGTAGTGGAAGTTATGGTGAGGAGAAGGATAAGCTAAGGATCTTGAAAACTCAGGTTTTAAGCTTTGGTATTCAGGCAAAACAGAACGAGAAATGTTGTTGGAATCATCGTGGACAAGAATCTAATGCAAGATGTTGTAGATTGCAAATTTTGGGAAAATCTTGGAGAATTGTAGATTTAAATGGACATGTGGCCAAGGAGAAAGGCAACTACGAAGGTTTTCATGGTGGCTATGGTTTTTGGGGGAGAAACGATGATGGGGAAGTCATTTTGGAGTTTGCAATGGCATACGATCTTTTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

118

Amino Acids

13.3

Weight (kDa)

8.71

Isoelectric Point (pI)

20.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0022520)

Species Orthologous Gene IDs
pyrus_communis pycom01g03100 pycom10g19960 pycom11g12410 pycom15g29570

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 98
AcoI YGGCCR 1 cut(s) 243
AcsI RAATTY 1 cut(s) 198
AflIII ACRYGT 1 cut(s) 238
AgsI TTSAA 1 cut(s) 97
AluBI AGCT 2 cut(s) 85, 114
AluI AGCT 2 cut(s) 85, 114
AlwI GGATC 1 cut(s) 98
AoxI GGCC 1 cut(s) 243
ApoI RAATTY 1 cut(s) 198
Asp700I GAANNNNTTC 1 cut(s) 270
AsuHPI GGTGA 1 cut(s) 80
BalI TGGCCA 1 cut(s) 245
BccI CCATC 1 cut(s) 302
BfaI CTAG 1 cut(s) 8
Bpu10I CCTNAGC 1 cut(s) 86
BsaJI CCNNGG 1 cut(s) 246
Bse3DI GCAATG 1 cut(s) 339
BseDI CCNNGG 1 cut(s) 246
BseMI GCAATG 1 cut(s) 339
BseMII CTCAG 1 cut(s) 116
BseRI GAGGAG 1 cut(s) 86
BshFI GGCC 1 cut(s) 245
BsnI GGCC 1 cut(s) 245
Bsp143I GATC 2 cut(s) 90, 343
BspANI GGCC 1 cut(s) 245
BspCNI CTCAG 1 cut(s) 115
BspPI GGATC 1 cut(s) 98
BsrDI GCAATG 1 cut(s) 339
BssECI CCNNGG 1 cut(s) 246
BssMI GATC 2 cut(s) 90, 343
BssT1I CCWWGG 1 cut(s) 246
BstDEI CTNAG 2 cut(s) 86, 102
BstKTI GATC 2 cut(s) 93, 346
BstMBI GATC 2 cut(s) 90, 343
BstNSI RCATGY 1 cut(s) 242
BstX2I RGATCY 1 cut(s) 90
BstYI RGATCY 1 cut(s) 90
BsuRI GGCC 1 cut(s) 245
CviAII CATG 2 cut(s) 239, 275
CviJI RGCY 4 cut(s) 85, 114, 245, 282
CviKI_1 RGCY 4 cut(s) 85, 114, 245, 282
DdeI CTNAG 2 cut(s) 86, 102
DpnI GATC 2 cut(s) 92, 345
DpnII GATC 2 cut(s) 90, 343
DraI TTTAAA 1 cut(s) 231
EaeI YGGCCR 1 cut(s) 243
Eco130I CCWWGG 1 cut(s) 246
EcoT14I CCWWGG 1 cut(s) 246
ErhI CCWWGG 1 cut(s) 246
FaeI CATG 2 cut(s) 242, 278
FaiI YATR 7 cut(s) 23, 48, 66, 240, 276, 285, 340
FatI CATG 2 cut(s) 238, 274
FspBI CTAG 1 cut(s) 8
HaeIII GGCC 1 cut(s) 245
Hin1II CATG 2 cut(s) 242, 278
HindIII AAGCTT 1 cut(s) 112
HinfI GANTC 2 cut(s) 154, 170
HphI GGTGA 1 cut(s) 80
Hpy166II GTNNAC 1 cut(s) 164
Hpy188III TCNNGA 1 cut(s) 94
Hpy8I GTNNAC 1 cut(s) 164
HpyAV CCTTC 2 cut(s) 70, 260
HpyCH4V TGCA 3 cut(s) 179, 196, 332
HpyF3I CTNAG 2 cut(s) 86, 102
Hsp92II CATG 2 cut(s) 242, 278
Kzo9I GATC 2 cut(s) 90, 343
LpnPI CCDG 2 cut(s) 89, 110
MaeI CTAG 1 cut(s) 8
MalI GATC 2 cut(s) 92, 345
MboI GATC 2 cut(s) 90, 343
MflI RGATCY 1 cut(s) 90
MlsI TGGCCA 1 cut(s) 245
MluCI AATT 2 cut(s) 198, 219
MluNI TGGCCA 1 cut(s) 245
MmeI TCCRAC 1 cut(s) 131
MnlI CCTC 1 cut(s) 64
Mox20I TGGCCA 1 cut(s) 245
MroXI GAANNNNTTC 1 cut(s) 270
MscI TGGCCA 1 cut(s) 245
MseI TTAA 4 cut(s) 32, 110, 230, 352
Msp20I TGGCCA 1 cut(s) 245
NdeII GATC 2 cut(s) 90, 343
NlaIII CATG 2 cut(s) 242, 278
NspI RCATGY 1 cut(s) 242
PciI ACATGT 1 cut(s) 238
PdmI GAANNNNTTC 1 cut(s) 270
PfeI GAWTC 2 cut(s) 154, 170
PscI ACATGT 1 cut(s) 238
PsuI RGATCY 1 cut(s) 90
SaqAI TTAA 4 cut(s) 32, 110, 230, 352
Sau3AI GATC 2 cut(s) 90, 343
SetI ASST 4 cut(s) 87, 108, 116, 271
SmiI ATTTAAAT 1 cut(s) 231
Sse9I AATT 2 cut(s) 198, 219
SspMI CTAG 1 cut(s) 8
StyI CCWWGG 1 cut(s) 246
SwaI ATTTAAAT 1 cut(s) 231
TasI AATT 2 cut(s) 198, 219
TfiI GAWTC 2 cut(s) 154, 170
Tru1I TTAA 4 cut(s) 32, 110, 230, 352
Tru9I TTAA 4 cut(s) 32, 110, 230, 352
TspDTI ATGAA 1 cut(s) 263
XapI RAATTY 1 cut(s) 198
XceI RCATGY 1 cut(s) 242
XmnI GAANNNNTTC 1 cut(s) 270
XspI CTAG 1 cut(s) 8
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.