pycom15g29570

2S seed storage protein 5-like

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr15
Physical Location & Seq
Forward (+)
26490106 .. 26490351
246 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom15g29570.1

Sequence Viewer

Length: 246 bp
ATGTACATATCAAAAGAGAGAAAAAAGAACAAGACTTGGAAGTTCCCAAGGACTAGATGGTGGAATCTAAAAGAAGAAAAACAAGCCATTTTCAAAGAGAAAGTAATCACCCAATGCGTGTGGGATAGAGAGGGGGAAGCTAGCCAAAGGTGGGATTCCATGGCTAGTTGTATCCGAAAAGTAGCAAAAGAGTTATTAGAAGAGTCCAAAGGCTTTGCTCCACACCAAAAGGAATCTTGGTGTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

82

Amino Acids

9.89

Weight (kDa)

9.55

Isoelectric Point (pI)

48.68

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0022520)

Species Orthologous Gene IDs
pyrus_communis pycom01g03100 pycom10g19960 pycom11g12410 pycom15g29570

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 5
AfiI CCNNNNNNNGG 1 cut(s) 151
AgsI TTSAA 1 cut(s) 94
AluBI AGCT 1 cut(s) 140
AluI AGCT 1 cut(s) 140
AsuHPI GGTGA 1 cut(s) 100
AsuNHI GCTAGC 1 cut(s) 140
BccI CCATC 1 cut(s) 51
BciVI GTATCC 1 cut(s) 182
BfaI CTAG 3 cut(s) 54, 141, 165
BfuI GTATCC 1 cut(s) 182
BmtI GCTAGC 1 cut(s) 144
BsaJI CCNNGG 2 cut(s) 47, 159
Bsc4I CCNNNNNNNGG 1 cut(s) 151
BseDI CCNNGG 2 cut(s) 47, 159
BseLI CCNNNNNNNGG 1 cut(s) 151
BslI CCNNNNNNNGG 1 cut(s) 151
Bsp1407I TGTACA 1 cut(s) 3
Bsp19I CCATGG 1 cut(s) 159
BspOI GCTAGC 1 cut(s) 144
BsrGI TGTACA 1 cut(s) 3
BssECI CCNNGG 2 cut(s) 47, 159
BssT1I CCWWGG 2 cut(s) 47, 159
Bst6I CTCTTC 1 cut(s) 195
BstAUI TGTACA 1 cut(s) 3
BstC8I GCNNGC 1 cut(s) 142
BstDSI CCRYGG 1 cut(s) 159
BsuI GTATCC 1 cut(s) 182
BtgI CCRYGG 1 cut(s) 159
Cac8I GCNNGC 1 cut(s) 142
Csp6I GTAC 1 cut(s) 4
CspCI CAANNNNNGTGG 2 cut(s) 101, 136
CviAII CATG 1 cut(s) 160
CviJI RGCY 5 cut(s) 86, 140, 144, 164, 213
CviKI_1 RGCY 5 cut(s) 86, 140, 144, 164, 213
CviQI GTAC 1 cut(s) 4
Eam1104I CTCTTC 1 cut(s) 195
EarI CTCTTC 1 cut(s) 195
Eco130I CCWWGG 2 cut(s) 47, 159
EcoT14I CCWWGG 2 cut(s) 47, 159
ErhI CCWWGG 2 cut(s) 47, 159
FaeI CATG 1 cut(s) 163
FaiI YATR 2 cut(s) 8, 161
FatI CATG 1 cut(s) 159
FspBI CTAG 3 cut(s) 54, 141, 165
Hin1II CATG 1 cut(s) 163
HinfI GANTC 4 cut(s) 64, 155, 203, 233
HphI GGTGA 1 cut(s) 100
Hpy188I TCNGA 1 cut(s) 176
Hsp92II CATG 1 cut(s) 163
LmnI GCTCC 1 cut(s) 223
MaeI CTAG 3 cut(s) 54, 141, 165
MboII GAAGA 2 cut(s) 86, 212
MlyI GAGTC 1 cut(s) 212
MnlI CCTC 1 cut(s) 124
NcoI CCATGG 1 cut(s) 159
NheI GCTAGC 1 cut(s) 140
NlaIII CATG 1 cut(s) 163
PfeI GAWTC 3 cut(s) 64, 155, 233
PleI GAGTC 1 cut(s) 211
PpsI GAGTC 1 cut(s) 211
RsaI GTAC 1 cut(s) 5
RsaNI GTAC 1 cut(s) 4
SchI GAGTC 1 cut(s) 212
SetI ASST 2 cut(s) 142, 152
SgeI CNNG 9 cut(s) 43, 48, 60, 66, 95, 130, 153, 172, 177
SspMI CTAG 3 cut(s) 54, 141, 165
StyI CCWWGG 2 cut(s) 47, 159
TatI WGTACW 1 cut(s) 3
TfiI GAWTC 3 cut(s) 64, 155, 233
XcmI CCANNNNNNNNNTGG 1 cut(s) 54
XspI CTAG 3 cut(s) 54, 141, 165
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.